Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TPRN Gene

Aliases for TPRN Gene

  • Taperin 2 3 3 5
  • C9orf75 3 4
  • Chromosome 9 Open Reading Frame 75 2
  • Deafness, Autosomal Recessive 79 2
  • DFNB79 3

External Ids for TPRN Gene

Previous HGNC Symbols for TPRN Gene

  • C9orf75
  • DFNB79

Previous GeneCards Identifiers for TPRN Gene

  • GC09M140086
  • GC09M109546

Summaries for TPRN Gene

Entrez Gene Summary for TPRN Gene

  • This locus encodes a sensory epithelial protein. It was defined by linkage analysis in three Pakistani families to lie between D9S1818 (centromeric) and D9SH6 (telomeric). Mutations at this locus have been associated with autosomal recessive deafness. [provided by RefSeq, Oct 2010]

GeneCards Summary for TPRN Gene

TPRN (Taperin) is a Protein Coding gene. Diseases associated with TPRN include Deafness, Autosomal Recessive 79 and Autosomal Recessive Non-Syndromic Sensorineural Deafness Type Dfnb. Gene Ontology (GO) annotations related to this gene include phosphatase binding. An important paralog of this gene is PPP1R18.

Additional gene information for TPRN Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TPRN Gene

Genomics for TPRN Gene

GeneHancer (GH) Regulatory Elements for TPRN Gene

Promoters and enhancers for TPRN Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH09J137193 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 651.6 +5.7 5744 9.8 HDGF PKNOX1 SMAD1 FOXA2 MLX ARID4B SIN3A DMAP1 ZNF2 ZBTB7B TPRN EHMT1 ANAPC2 ENTR1 LOC100418938 NDOR1 INPP5E DPH7 MAN1B1 SNAPC4
GH09J137204 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 650.7 -1.5 -1519 3.3 ARID4B SIN3A DMAP1 ZNF2 YY1 POLR2B E2F8 ZNF207 ZNF143 SP3 NDOR1 TPRN TMEM203 PIR53478 EHMT1 ENTR1 CYSRT1 SLC34A3 RNF208 ENSG00000284976
GH09J137166 Promoter/Enhancer 2.1 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 19.4 +33.0 33048 10.1 HDGF SIN3A ZNF2 ZBTB7B GLIS2 ZNF143 KLF7 SP3 REST GMEB1 ENSG00000261793 MIR3621 LRRC26 TMEM210 TPRN IL9RP1 TMEM203 NDOR1 GRIN1 DPP7
GH09J136884 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 10.3 +317.9 317918 3.1 HDGF PKNOX1 SMAD1 ARID4B SIN3A DMAP1 ZBTB7B YY1 POLR2B E2F8 LOC105376326 MIR4479 TRAF2 EHMT1 ENTR1 ANAPC2 PHPT1 SNHG7 LOC100418938 MAMDC4
GH09J136881 Promoter/Enhancer 1.9 EPDnew Ensembl ENCODE dbSUPER 10.3 +321.5 321531 2.7 HDGF PKNOX1 FOXA2 MLX ARID4B SIN3A DMAP1 YY1 SLC30A9 FOS TRAF2 PHPT1 MAMDC4 AJM1 TMEM141 LCN12 PRR31 C8G FBXW5 RABL6
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around TPRN on UCSC Golden Path with GeneCards custom track

Genomic Locations for TPRN Gene

Genomic Locations for TPRN Gene
12,577 bases
Minus strand
12,577 bases
Minus strand

Genomic View for TPRN Gene

Genes around TPRN on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TPRN Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TPRN Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TPRN Gene

Proteins for TPRN Gene

  • Protein details for TPRN Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein Accession:
    Secondary Accessions:
    • B7ZKU5
    • Q5VSG5
    • Q5VSG6
    • Q6IPP2
    • Q8NCH2

    Protein attributes for TPRN Gene

    711 amino acids
    Molecular mass:
    75556 Da
    Quaternary structure:
    No Data Available
    • Sequence=AAI11501.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305};

    Alternative splice isoforms for TPRN Gene


neXtProt entry for TPRN Gene

Post-translational modifications for TPRN Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for TPRN Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for TPRN Gene

Domains & Families for TPRN Gene

Gene Families for TPRN Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for TPRN Gene

Suggested Antigen Peptide Sequences for TPRN Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the taperin family.
  • Belongs to the taperin family.
genes like me logo Genes that share domains with TPRN: view

Function for TPRN Gene

Phenotypes From GWAS Catalog for TPRN Gene

Gene Ontology (GO) - Molecular Function for TPRN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
GO:0005515 protein binding IPI 22321011
GO:0019902 phosphatase binding IEA --
genes like me logo Genes that share ontologies with TPRN: view
genes like me logo Genes that share phenotypes with TPRN: view

Human Phenotype Ontology for TPRN Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for TPRN Gene

MGI Knock Outs for TPRN:
  • Tprn Tprn<tm1.1(KOMP)Vlcg>

Animal Model Products

miRNA for TPRN Gene

miRTarBase miRNAs that target TPRN

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for TPRN Gene

Localization for TPRN Gene

Subcellular locations from UniProtKB/Swiss-Prot for TPRN Gene

Cell projection, stereocilium. Note=Localized prominently at the taper regions of hair cell stereocilia. {ECO:0000250}.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TPRN gene
Compartment Confidence
nucleus 3
plasma membrane 2
cytosol 2

Subcellular locations from the

Human Protein Atlas (HPA)
  • Plasma membrane (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for TPRN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0032420 stereocilium ISS --
GO:0042995 cell projection IEA --
genes like me logo Genes that share ontologies with TPRN: view

Pathways & Interactions for TPRN Gene

No Data Available

Gene Ontology (GO) - Biological Process for TPRN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007605 sensory perception of sound IMP 20170898
genes like me logo Genes that share ontologies with TPRN: view

No data available for Pathways by source and SIGNOR curated interactions for TPRN Gene

Drugs & Compounds for TPRN Gene

No Compound Related Data Available

Transcripts for TPRN Gene

mRNA/cDNA for TPRN Gene

Unigene Clusters for TPRN Gene

Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for TPRN Gene

No ASD Table

Relevant External Links for TPRN Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for TPRN Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TPRN Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for TPRN Gene

This gene is overexpressed in Pancreas (x6.5).

Protein differential expression in normal tissues from HIPED for TPRN Gene

This gene is overexpressed in Pancreatic juice (14.7), Peripheral blood mononuclear cells (12.5), Saliva (12.5), Bone marrow mesenchymal stem cell (7.9), and Heart (7.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for TPRN Gene

NURSA nuclear receptor signaling pathways regulating expression of TPRN Gene:


SOURCE GeneReport for Unigene cluster for TPRN Gene:


mRNA Expression by UniProt/SwissProt for TPRN Gene:

Tissue specificity: Expression is detected in fetal cochlea.

Evidence on tissue expression from TISSUES for TPRN Gene

  • Nervous system(4.2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for TPRN Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • nervous
  • skeletal muscle
  • skeleton
Head and neck:
  • brain
  • cerebellum
  • cranial nerve
  • ear
  • eye
  • head
  • inner ear
  • middle ear
  • outer ear
  • skull
  • peripheral nerve
  • peripheral nervous system
genes like me logo Genes that share expression patterns with TPRN: view

No data available for Protein tissue co-expression partners for TPRN Gene

Orthologs for TPRN Gene

This gene was present in the common ancestor of chordates.

Orthologs for TPRN Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia TPRN 34
  • 92 (a)
(Bos Taurus)
Mammalia TPRN 34 33
  • 77.14 (n)
(Rattus norvegicus)
Mammalia Tprn 33
  • 76.77 (n)
(Mus musculus)
Mammalia Tprn 16 34 33
  • 76.52 (n)
(Canis familiaris)
Mammalia TPRN 34
  • 65 (a)
(Monodelphis domestica)
Mammalia TPRN 34
  • 37 (a)
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 13 (a)
(Gallus gallus)
Aves TPRN 34 33
  • 63.35 (n)
(Anolis carolinensis)
Reptilia TPRN 34
  • 36 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC101731408 33
  • 52.58 (n)
(Danio rerio)
Actinopterygii tprn 34
  • 24 (a)
Species where no ortholog for TPRN was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for TPRN Gene

Gene Tree for TPRN (if available)
Gene Tree for TPRN (if available)
Evolutionary constrained regions (ECRs) for TPRN: view image

Paralogs for TPRN Gene

Paralogs for TPRN Gene

(1) SIMAP similar genes for TPRN Gene using alignment to 3 proteins:

genes like me logo Genes that share paralogs with TPRN: view

Variants for TPRN Gene

Sequence variations from dbSNP and Humsavar for TPRN Gene

SNP ID Clin Chr 09 pos Variation AA Info Type
rs139520402 likely-benign, uncertain-significance, not specified, Deafness, autosomal recessive 79 137,192,309(-) C/A/T coding_sequence_variant, missense_variant
rs267607135 pathogenic, Deafness, autosomal recessive 79 137,199,473(-) C/T coding_sequence_variant, stop_gained
rs387906219 pathogenic, Deafness, autosomal recessive 79 137,199,285(-) GGG/GG coding_sequence_variant, frameshift
rs387906220 pathogenic, Deafness, autosomal recessive 79 137,200,475(-) CAGCCGCGCCCC/CAGCCGCGCCCCAGCCGCGCCCC coding_sequence_variant, frameshift

Structural Variations from Database of Genomic Variants (DGV) for TPRN Gene

Variant ID Type Subtype PubMed ID
nsv951207 CNV deletion 24416366
nsv616012 CNV loss 21841781
nsv616010 CNV loss 21841781
nsv616007 CNV loss 21841781
nsv524322 CNV loss 19592680
nsv1161918 CNV duplication 26073780
nsv1126930 CNV deletion 24896259
nsv1077201 CNV deletion 25765185
esv2422220 CNV deletion 17116639
dgv13010n54 CNV loss 21841781
dgv13009n54 CNV loss 21841781

Variation tolerance for TPRN Gene

Gene Damage Index Score: 6.15; 75.71% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for TPRN Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TPRN Gene

Disorders for TPRN Gene

MalaCards: The human disease database

(4) MalaCards diseases for TPRN Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
deafness, autosomal recessive 79
  • dfnb79
autosomal recessive non-syndromic sensorineural deafness type dfnb
  • autosomal recessive isolated neurosensory deafness type dfnb
deafness, autosomal recessive
nonsyndromic deafness
  • nonsyndromic hearing loss
- elite association - COSMIC cancer census association via MalaCards
Search TPRN in MalaCards View complete list of genes associated with diseases


  • Deafness, autosomal recessive, 79 (DFNB79) [MIM:613307]: A form of non-syndromic deafness characterized by progressive and severe sensorineural hearing loss. There are no symptoms of vestibular dysfunction. {ECO:0000269 PubMed:20170898, ECO:0000269 PubMed:20170899}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for TPRN

genes like me logo Genes that share disorders with TPRN: view

No data available for Genatlas for TPRN Gene

Publications for TPRN Gene

  1. Targeted capture and next-generation sequencing identifies C9orf75, encoding taperin, as the mutated gene in nonsyndromic deafness DFNB79. (PMID: 20170899) Rehman AU … Friedman TB (American journal of human genetics 2010) 2 3 4 58
  2. Mutations in TPRN cause a progressive form of autosomal-recessive nonsyndromic hearing loss. (PMID: 20170898) Li Y … Wollnik B (American journal of human genetics 2010) 2 3 4 58
  3. Systematic Analysis of Human Protein Phosphatase Interactions and Dynamics. (PMID: 28330616) Yadav L … Varjosalo M (Cell systems 2017) 3 58
  4. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 58
  5. Phenotypic and Interaction Profiling of the Human Phosphatases Identifies Diverse Mitotic Regulators. (PMID: 27880917) St-Denis N … Gingras AC (Cell reports 2016) 3 58

Products for TPRN Gene

Sources for TPRN Gene

Loading form....