Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CHRNA6 Gene

Aliases for CHRNA6 Gene

  • Cholinergic Receptor Nicotinic Alpha 6 Subunit 2 3 5
  • Acetylcholine Receptor, Nicotinic, Alpha 6 (Neuronal) 2 3
  • Cholinergic Receptor, Nicotinic, Alpha Polypeptide 6 2 3
  • Cholinergic Receptor, Nicotinic, Alpha 6 (Neuronal) 2 3
  • Cholinergic Receptor, Nicotinic Alpha 6 2 3
  • Neuronal Acetylcholine Receptor Subunit Alpha-6 3
  • CHNRA6 3

External Ids for CHRNA6 Gene

Previous GeneCards Identifiers for CHRNA6 Gene

  • GC08M042362
  • GC08M042677
  • GC08M042625
  • GC08M041129

Summaries for CHRNA6 Gene

Entrez Gene Summary for CHRNA6 Gene

  • This gene encodes an alpha subunit of neuronal nicotinic acetylcholine receptors. These receptors consist of five subunits and function as ion channels involved in neurotransmission. The encoded protein is a subunit of neuronal nicotinic acetylcholine receptors that mediate dopaminergic neurotransmission and are activated by acetylcholine and exogenous nicotine. Alternatively spliced transcript variants have been observed for this gene. Single nucleotide polymorphisms in this gene have been associated with both nicotine and alcohol dependence. [provided by RefSeq, Dec 2010]

GeneCards Summary for CHRNA6 Gene

CHRNA6 (Cholinergic Receptor Nicotinic Alpha 6 Subunit) is a Protein Coding gene. Diseases associated with CHRNA6 include Alcohol Dependence and Drug Dependence. Among its related pathways are Transmission across Chemical Synapses and Postsynaptic nicotinic acetylcholine receptors. Gene Ontology (GO) annotations related to this gene include extracellular ligand-gated ion channel activity and acetylcholine receptor activity. An important paralog of this gene is CHRNA3.

UniProtKB/Swiss-Prot for CHRNA6 Gene

  • After binding acetylcholine, the AChR responds by an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane.

Gene Wiki entry for CHRNA6 Gene

Additional gene information for CHRNA6 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CHRNA6 Gene

Genomics for CHRNA6 Gene

GeneHancer (GH) Regulatory Elements for CHRNA6 Gene

Promoters and enhancers for CHRNA6 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH08J042768 Promoter/Enhancer 1.5 EPDnew Ensembl ENCODE 650.3 +27.6 27646 1.4 HDGF PKNOX1 BMI1 BATF IRF4 ZNF335 ATF7 FOS IKZF2 USF2 CHRNA6 LOC100288666
GH08J042797 Enhancer 0.3 Ensembl 650.7 -1.2 -1209 0.4 NFATC3 CHRNA6 CHRNB3 LOC105379396 THAP1
GH08J042789 Enhancer 1.1 Ensembl ENCODE 0.4 +6.1 6097 1.7 PKNOX1 ATF1 ARNT FEZF1 IRF4 NCOA2 TCF12 ZNF766 ZNF207 ATF7 CHRNB3 LOC105379396 HOOK3 RNF170 CHRNA6 LOC100288666
GH08J042841 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 0.2 -46.5 -46489 3.5 HDGF PKNOX1 CLOCK SMAD1 FOXA2 ARNT ARID4B SIN3A FEZF1 DMAP1 THAP1 HOOK3 IKBKB KAT6A RNF170 FNTA CHRNA6
GH08J042805 Enhancer 1 Ensembl ENCODE 0.4 -9.0 -9009 0.8 RB1 ARID4B ZNF2 RAD21 RFX5 ZNF335 ZNF213 ARID2 ZNF143 BCLAF1 LOC105379396 RNF170 HOOK3 CHRNA6 THAP1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around CHRNA6 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the CHRNA6 gene promoter:
  • STAT5A
  • AP-1
  • Cdc5
  • Bach2
  • S8
  • PPAR-gamma2
  • PPAR-gamma1
  • POU2F1a
  • POU2F1
  • STAT3

Genomic Locations for CHRNA6 Gene

Genomic Locations for CHRNA6 Gene
chr8:42,752,620-42,796,392
(GRCh38/hg38)
Size:
43,773 bases
Orientation:
Minus strand
chr8:42,607,763-42,651,535
(GRCh37/hg19)
Size:
43,773 bases
Orientation:
Minus strand

Genomic View for CHRNA6 Gene

Genes around CHRNA6 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CHRNA6 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CHRNA6 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CHRNA6 Gene

Proteins for CHRNA6 Gene

  • Protein details for CHRNA6 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q15825-ACHA6_HUMAN
    Recommended name:
    Neuronal acetylcholine receptor subunit alpha-6
    Protein Accession:
    Q15825
    Secondary Accessions:
    • B2R8V4
    • B4DQH1

    Protein attributes for CHRNA6 Gene

    Size:
    494 amino acids
    Molecular mass:
    56898 Da
    Quaternary structure:
    • Neuronal AChR seems to be composed of two different types of subunits: alpha and non-alpha (beta). Interacts with LYPD6 (PubMed:27344019).

    Alternative splice isoforms for CHRNA6 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for CHRNA6 Gene

Post-translational modifications for CHRNA6 Gene

  • Glycosylation at posLast=171171 and posLast=5454
  • Modification sites at PhosphoSitePlus

Other Protein References for CHRNA6 Gene

No data available for DME Specific Peptides for CHRNA6 Gene

Domains & Families for CHRNA6 Gene

Gene Families for CHRNA6 Gene

HGNC:
IUPHAR :
Human Protein Atlas (HPA):
  • Predicted intracellular proteins
  • Predicted membrane proteins

Graphical View of Domain Structure for InterPro Entry

Q15825

UniProtKB/Swiss-Prot:

ACHA6_HUMAN :
  • Belongs to the ligand-gated ion channel (TC 1.A.9) family. Acetylcholine receptor (TC 1.A.9.1) subfamily. Alpha-6/CHRNA6 sub-subfamily.
Family:
  • Belongs to the ligand-gated ion channel (TC 1.A.9) family. Acetylcholine receptor (TC 1.A.9.1) subfamily. Alpha-6/CHRNA6 sub-subfamily.
genes like me logo Genes that share domains with CHRNA6: view

Function for CHRNA6 Gene

Molecular function for CHRNA6 Gene

UniProtKB/Swiss-Prot Function:
After binding acetylcholine, the AChR responds by an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane.

Phenotypes From GWAS Catalog for CHRNA6 Gene

Gene Ontology (GO) - Molecular Function for CHRNA6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005216 ion channel activity IEA --
GO:0005230 CONTRIBUTES_TO extracellular ligand-gated ion channel activity IEA,IBA --
GO:0005515 protein binding IPI 27344019
GO:0015276 ligand-gated ion channel activity TAS --
GO:0015464 acetylcholine receptor activity TAS 8906617
genes like me logo Genes that share ontologies with CHRNA6: view
genes like me logo Genes that share phenotypes with CHRNA6: view

Animal Models for CHRNA6 Gene

MGI Knock Outs for CHRNA6:

Animal Model Products

miRNA for CHRNA6 Gene

Clone Products

  • R&D Systems cDNA Clones for CHRNA6 (Nicotinic Acetylcholine R alpha 6/CHRNA6)

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for CHRNA6 Gene

Localization for CHRNA6 Gene

Subcellular locations from UniProtKB/Swiss-Prot for CHRNA6 Gene

Cell junction, synapse, postsynaptic cell membrane; Multi-pass membrane protein. Cell membrane; Multi-pass membrane protein.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CHRNA6 gene
Compartment Confidence
plasma membrane 5

Gene Ontology (GO) - Cellular Components for CHRNA6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005886 plasma membrane TAS --
GO:0005887 integral component of plasma membrane IBA --
GO:0005892 acetylcholine-gated channel complex TAS,IBA --
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with CHRNA6: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for CHRNA6 Gene

Pathways & Interactions for CHRNA6 Gene

genes like me logo Genes that share pathways with CHRNA6: view

Gene Ontology (GO) - Biological Process for CHRNA6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006811 ion transport IEA --
GO:0007165 signal transduction IEA,TAS 8906617
GO:0007268 chemical synaptic transmission TAS 8906617
GO:0007271 synaptic transmission, cholinergic IBA --
GO:0007274 neuromuscular synaptic transmission IBA --
genes like me logo Genes that share ontologies with CHRNA6: view

No data available for SIGNOR curated interactions for CHRNA6 Gene

Drugs & Compounds for CHRNA6 Gene

(15) Drugs for CHRNA6 Gene - From: DrugBank, DGIdb, IUPHAR, and HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Ethanol Approved Pharma Target 2326
Mecamylamine Approved, Investigational Pharma Channel blocker, antagonist 27
Cytisine Approved, Investigational Pharma Target, agonist 0
Galantamine Approved Pharma Target, allosteric modulator Acetylcholinesterase inhibitor 106
Nicotine Approved Pharma Antagonist, Activation, Activator, Target, agonist 1188

(4) Additional Compounds for CHRNA6 Gene - From: IUPHAR

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
[<sup>125</sup>I]alpha-conotoxin MII
alpha-conotoxin MII
Antagonist
alpha-conotoxin MII [H9A, L15A]
Antagonist
alpha-conotoxin PIA
Antagonist
genes like me logo Genes that share compounds with CHRNA6: view

Transcripts for CHRNA6 Gene

mRNA/cDNA for CHRNA6 Gene

(2) REFSEQ mRNAs :
(5) Additional mRNA sequences :
(12) Selected AceView cDNA sequences:
(5) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for CHRNA6 Gene

Cholinergic receptor, nicotinic, alpha 6 (neuronal):
Representative Sequences:

Clone Products

  • R&D Systems cDNA Clones for CHRNA6 (Nicotinic Acetylcholine R alpha 6/CHRNA6)

Alternative Splicing Database (ASD) splice patterns (SP) for CHRNA6 Gene

ExUns: 1a · 1b · 1c ^ 2a · 2b ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7
SP1: - -
SP2: -
SP3:

Relevant External Links for CHRNA6 Gene

GeneLoc Exon Structure for
CHRNA6
ECgene alternative splicing isoforms for
CHRNA6

Expression for CHRNA6 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CHRNA6 Gene

mRNA differential expression in normal tissues according to GTEx for CHRNA6 Gene

This gene is overexpressed in Brain - Cerebellar Hemisphere (x10.0), Brain - Substantia nigra (x7.0), and Brain - Cerebellum (x6.9).

Protein differential expression in normal tissues from HIPED for CHRNA6 Gene

This gene is overexpressed in Peripheral blood mononuclear cells (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for CHRNA6 Gene



Protein tissue co-expression partners for CHRNA6 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of CHRNA6 Gene:

CHRNA6

SOURCE GeneReport for Unigene cluster for CHRNA6 Gene:

Hs.103128

Evidence on tissue expression from TISSUES for CHRNA6 Gene

  • Nervous system(4.2)
  • Skin(4)
genes like me logo Genes that share expression patterns with CHRNA6: view

No data available for mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for CHRNA6 Gene

Orthologs for CHRNA6 Gene

This gene was present in the common ancestor of animals.

Orthologs for CHRNA6 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia CHRNA6 34 33
  • 99.6 (n)
OneToOne
dog
(Canis familiaris)
Mammalia CHRNA6 34 33
  • 87.58 (n)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia CHRNA6 34
  • 85 (a)
OneToOne
cow
(Bos Taurus)
Mammalia CHRNA6 34 33
  • 84.41 (n)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia CHRNA6 34
  • 82 (a)
OneToOne
rat
(Rattus norvegicus)
Mammalia Chrna6 33
  • 81.95 (n)
mouse
(Mus musculus)
Mammalia Chrna6 16 34 33
  • 81.85 (n)
chicken
(Gallus gallus)
Aves CHRNA6 34 33
  • 75.65 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia CHRNA6 34
  • 78 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100495287 33
  • 69.63 (n)
zebrafish
(Danio rerio)
Actinopterygii chrna6 34 33
  • 66.11 (n)
OneToOne
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP000329 33
  • 58.48 (n)
fruit fly
(Drosophila melanogaster)
Insecta nAcRalpha-7E 35 33
  • 58.02 (n)
nAcRalpha-96Ab 35
  • 50 (a)
nAcRalpha-96Aa 35
  • 50 (a)
nAcR&bgr;-96A 35
  • 45 (a)
nAcR&bgr;-64B 35
  • 43 (a)
nAcRalpha-80B 35
  • 40 (a)
nAcRalpha-30D 35
  • 30 (a)
nAcR&bgr;-21C 35
  • 28 (a)
worm
(Caenorhabditis elegans)
Secernentea unc-38 35 33
  • 55.65 (n)
unc-63 35
  • 45 (a)
acr-10 35
  • 41 (a)
acr-3 35
  • 40 (a)
unc-29 35
  • 39 (a)
acr-12 35
  • 39 (a)
acr-2 35
  • 39 (a)
lev-1 35
  • 38 (a)
ZK973.5 35
  • 36 (a)
acr-7 35
  • 36 (a)
acr-8 35
  • 33 (a)
acr-15 35
  • 32 (a)
F18G5.4 35
  • 32 (a)
Y73F8A.30 35
  • 31 (a)
acr-5 35
  • 30 (a)
acr-13 35
  • 30 (a)
acr-22 35
  • 30 (a)
acr-14 35
  • 29 (a)
Y44A6E.1 35
  • 28 (a)
acr-17 35
  • 28 (a)
acr-23 35
  • 27 (a)
deg-3 35
  • 26 (a)
Y57G11C.2 35
  • 25 (a)
acr-18 35
  • 24 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 54 (a)
OneToMany
Species where no ortholog for CHRNA6 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for CHRNA6 Gene

ENSEMBL:
Gene Tree for CHRNA6 (if available)
TreeFam:
Gene Tree for CHRNA6 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for CHRNA6: view image

Paralogs for CHRNA6 Gene

Paralogs for CHRNA6 Gene

(19) SIMAP similar genes for CHRNA6 Gene using alignment to 3 proteins:

  • ACHA6_HUMAN
  • E9PP97_HUMAN
  • L8ECB0_HUMAN
genes like me logo Genes that share paralogs with CHRNA6: view

Variants for CHRNA6 Gene

Sequence variations from dbSNP and Humsavar for CHRNA6 Gene

SNP ID Clin Chr 08 pos Variation AA Info Type
rs1000107126 -- 42,760,088(-) A/T intron_variant
rs1000174694 -- 42,761,075(-) C/T intron_variant
rs1000460628 -- 42,766,065(-) G/A intron_variant
rs1000541384 -- 42,760,240(-) CACACTCATGCACACTCACAC/CACAC intron_variant
rs1000773572 -- 42,767,762(-) A/G intron_variant

Structural Variations from Database of Genomic Variants (DGV) for CHRNA6 Gene

Variant ID Type Subtype PubMed ID
dgv7186n100 CNV gain 25217958
nsv483102 CNV loss 15286789

Variation tolerance for CHRNA6 Gene

Residual Variation Intolerance Score: 26% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.34; 41.68% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CHRNA6 Gene

Human Gene Mutation Database (HGMD)
CHRNA6
SNPedia medical, phenotypic, and genealogical associations of SNPs for
CHRNA6

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CHRNA6 Gene

Disorders for CHRNA6 Gene

MalaCards: The human disease database

(3) MalaCards diseases for CHRNA6 Gene - From: HGMD, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
alcohol dependence
  • alcoholism
drug dependence
tobacco addiction
  • tobacco addiction, susceptibility to
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for CHRNA6

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with CHRNA6: view

No data available for UniProtKB/Swiss-Prot and Genatlas for CHRNA6 Gene

Publications for CHRNA6 Gene

  1. Comparative structure of human neuronal alpha 2-alpha 7 and beta 2-beta 4 nicotinic acetylcholine receptor subunits and functional expression of the alpha 2, alpha 3, alpha 4, alpha 7, beta 2, and beta 4 subunits. (PMID: 8906617) Elliott KJ … Harpold MM (Journal of molecular neuroscience : MN 1996) 2 3 4 58
  2. Functional interaction between Lypd6 and nicotinic acetylcholine receptors. (PMID: 27344019) Arvaniti M … Thomsen MS (Journal of neurochemistry 2016) 3 4 58
  3. Sequence variants at CHRNB3-CHRNA6 and CYP2A6 affect smoking behavior. (PMID: 20418888) Thorgeirsson TE … Stefansson K (Nature genetics 2010) 3 44 58
  4. Multiple cholinergic nicotinic receptor genes affect nicotine dependence risk in African and European Americans. (PMID: 20584212) Saccone NL … Bierut LJ (Genes, brain, and behavior 2010) 3 44 58
  5. A large-scale candidate gene association study of age at menarche and age at natural menopause. (PMID: 20734064) He C … Hunter DJ (Human genetics 2010) 3 44 58

Products for CHRNA6 Gene

Sources for CHRNA6 Gene

Content
Loading form....