Free for academic non-profit institutions. Other users need a Commercial license

Aliases for AMN Gene

Aliases for AMN Gene

  • Amnion Associated Transmembrane Protein 2 3 5
  • Visceral Endoderm-Specific Type 1 Transmembrane Protein 3
  • Amnionless Homolog (Mouse) 2
  • Amnionless Homolog 3
  • Protein Amnionless 3
  • Amnionless 3
  • PRO1028 3

External Ids for AMN Gene

Previous GeneCards Identifiers for AMN Gene

  • GC14P100780
  • GC14P097204
  • GC14P101379
  • GC14P102458
  • GC14P103388
  • GC14P083564

Summaries for AMN Gene

Entrez Gene Summary for AMN Gene

  • The protein encoded by this gene is a type I transmembrane protein. It is thought to modulate bone morphogenetic protein (BMP) receptor function by serving as an accessory or coreceptor, and thus facilitates or hinders BMP binding. It is known that the mouse AMN gene is expressed in the extraembryonic visceral endoderm layer during gastrulation, but it is found to be mutated in amnionless mouse. The encoded protein has sequence similarity to short gastrulation (Sog) and procollagen IIA proteins in Drosophila. [provided by RefSeq, Jul 2008]

GeneCards Summary for AMN Gene

AMN (Amnion Associated Transmembrane Protein) is a Protein Coding gene. Diseases associated with AMN include Megaloblastic Anemia 1 and Megaloblastic Anemia. Among its related pathways are Lipoprotein metabolism and Metabolism. Gene Ontology (GO) annotations related to this gene include signaling receptor binding.

UniProtKB/Swiss-Prot for AMN Gene

  • Necessary for efficient absorption of vitamin B12 (PubMed:12590260, PubMed:14576052). Required for normal CUBN-mediated protein transport in the kidney. May direct the production of trunk mesoderm during development by modulating a bone morphogenetic protein (BMP) signaling pathway in the underlying visceral endoderm (By similarity).

Gene Wiki entry for AMN Gene

Additional gene information for AMN Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for AMN Gene

Genomics for AMN Gene

GeneHancer (GH) Regulatory Elements for AMN Gene

Promoters and enhancers for AMN Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH14J102922 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 656.1 +3.1 3113 7.1 MLX ARID4B SIN3A YBX1 DMAP1 ZBTB7B ZNF48 ZNF121 GLIS2 SP3 AMN ENSG00000269940 ENSG00000259515
GH14J103007 Enhancer 1 ENCODE dbSUPER 6.7 +87.2 87188 4.9 NFIB MZF1 ZBTB40 RAD21 ZNF121 FOS RCOR1 ELK4 SMARCC1 ELF1 GC14M102996 TRAF3 AMN ENSG00000269940 APOPT1 PIR49144 CDC42BPB
GH14J102535 Enhancer 0.8 ENCODE dbSUPER 5.7 -386.0 -385953 1.3 NFIL3 ZFHX2 SAP130 HLF ZNF223 ZMYM3 ERF PRDM10 CEBPG PRDM4 CINP RCOR1 TECPR2 AMN MOK MIR4309 LOC105370680
GH14J102948 Enhancer 0.9 Ensembl ENCODE dbSUPER 4.9 +27.1 27087 1.9 ZNF687 NFIC POLR2A MAX MYC SPI1 AMN GC14P103480 PIR49144 CDC42BPB
GH14J102507 Promoter/Enhancer 2.4 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 1.7 -412.7 -412690 4.9 PKNOX1 FOXA2 ARID4B SIN3A DMAP1 SLC30A9 SP3 SP5 NFYC KAT8 ANKRD9 LOC105370679 RCOR1 CINP TECPR2 ZNF839 AMN
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around AMN on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the AMN gene promoter:
  • MIF-1
  • GATA-1
  • Chx10
  • CREB
  • LUN-1
  • c-Myc
  • Max
  • HSF1short
  • HSF1 (long)
  • Elk-1

Genomic Locations for AMN Gene

Genomic Locations for AMN Gene
chr14:102,922,548-102,933,596
(GRCh38/hg38)
Size:
11,049 bases
Orientation:
Plus strand
chr14:103,388,993-103,399,933
(GRCh37/hg19)
Size:
10,941 bases
Orientation:
Plus strand

Genomic View for AMN Gene

Genes around AMN on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
AMN Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for AMN Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for AMN Gene

Proteins for AMN Gene

  • Protein details for AMN Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9BXJ7-AMNLS_HUMAN
    Recommended name:
    Protein amnionless
    Protein Accession:
    Q9BXJ7
    Secondary Accessions:
    • Q6UX83

    Protein attributes for AMN Gene

    Size:
    453 amino acids
    Molecular mass:
    47754 Da
    Quaternary structure:
    • Interacts with CUBN/cubilin.
    Miscellaneous:
    • The mutations described in PubMed:12590260 all affect the N-terminus of the protein; shorter isoforms produced from alternative transcription start sites might still fulfill a role in embryogenesis. This might explain the discrepancy with the embryonic lethality of null mutants in mice.

    Alternative splice isoforms for AMN Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for AMN Gene

Post-translational modifications for AMN Gene

Other Protein References for AMN Gene

Antibody Products

  • Abcam antibodies for AMN
  • Boster Bio Antibodies for AMN

No data available for DME Specific Peptides for AMN Gene

Domains & Families for AMN Gene

Gene Families for AMN Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins
  • Predicted membrane proteins

Protein Domains for AMN Gene

Blocks:
InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for AMN Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with AMN: view

No data available for UniProtKB/Swiss-Prot for AMN Gene

Function for AMN Gene

Molecular function for AMN Gene

UniProtKB/Swiss-Prot Function:
Necessary for efficient absorption of vitamin B12 (PubMed:12590260, PubMed:14576052). Required for normal CUBN-mediated protein transport in the kidney. May direct the production of trunk mesoderm during development by modulating a bone morphogenetic protein (BMP) signaling pathway in the underlying visceral endoderm (By similarity).

Phenotypes From GWAS Catalog for AMN Gene

Gene Ontology (GO) - Molecular Function for AMN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005102 signaling receptor binding IPI 14576052
genes like me logo Genes that share ontologies with AMN: view
genes like me logo Genes that share phenotypes with AMN: view

Human Phenotype Ontology for AMN Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for AMN Gene

MGI Knock Outs for AMN:
  • Amn Amn<tm1Ehl>

Animal Model Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , miRNA , Transcription Factor Targets and HOMER Transcription for AMN Gene

Localization for AMN Gene

Subcellular locations from UniProtKB/Swiss-Prot for AMN Gene

Apical cell membrane; Single-pass type I membrane protein. Cell membrane; Peripheral membrane protein. Endosome. Membrane, coated pit.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for AMN gene
Compartment Confidence
plasma membrane 5
extracellular 5
endosome 4
cytoskeleton 1
mitochondrion 1
lysosome 1

Gene Ontology (GO) - Cellular Components for AMN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005615 extracellular space IDA 14576052
GO:0005768 endosome IEA --
GO:0005886 plasma membrane TAS --
GO:0005905 clathrin-coated pit IEA --
GO:0010008 endosome membrane TAS --
genes like me logo Genes that share ontologies with AMN: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for AMN Gene

Pathways & Interactions for AMN Gene

genes like me logo Genes that share pathways with AMN: view

Interacting Proteins for AMN Gene

Gene Ontology (GO) - Biological Process for AMN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006898 receptor-mediated endocytosis IMP 20088845
GO:0007275 multicellular organism development IEA --
GO:0007588 excretion IEA --
GO:0008104 protein localization IEA --
GO:0009235 cobalamin metabolic process TAS --
genes like me logo Genes that share ontologies with AMN: view

No data available for SIGNOR curated interactions for AMN Gene

Drugs & Compounds for AMN Gene

(32) Drugs for AMN Gene - From: DrugBank, ClinicalTrials, and HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Hydroxocobalamin Approved Pharma Target, other 337
Cyanocobalamin Approved Nutra Transporter, substrate 337
Vitamin E Approved, Vet_approved Nutra 434,438
Acetylcysteine Approved, Investigational Pharma Antioxidant;mucolytic agent 352
Bezafibrate Approved, Investigational Pharma Agonist 14
genes like me logo Genes that share compounds with AMN: view

Transcripts for AMN Gene

mRNA/cDNA for AMN Gene

Unigene Clusters for AMN Gene

Amnion associated transmembrane protein:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for AMN Gene

No ASD Table

Relevant External Links for AMN Gene

GeneLoc Exon Structure for
AMN
ECgene alternative splicing isoforms for
AMN

Expression for AMN Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for AMN Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for AMN Gene

This gene is overexpressed in Colon - Transverse (x13.5), Small Intestine - Terminal Ileum (x13.3), Kidney - Cortex (x9.3), and Liver (x8.3).

Protein differential expression in normal tissues from HIPED for AMN Gene

This gene is overexpressed in Kidney (62.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for AMN Gene



Protein tissue co-expression partners for AMN Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of AMN Gene:

AMN

SOURCE GeneReport for Unigene cluster for AMN Gene:

Hs.534494

mRNA Expression by UniProt/SwissProt for AMN Gene:

Q9BXJ7-AMNLS_HUMAN
Tissue specificity: Long isoforms are highly expressed in small intestine, colon and kidney (renal proximal tubule epithelial cells). Shorter isoforms are detected at lower levels in testis, thymus and peripheral blood leukocytes.

Evidence on tissue expression from TISSUES for AMN Gene

  • Kidney(4.6)
  • Intestine(2.8)
  • Stomach(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for AMN Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • immune
  • integumentary
  • nervous
  • skeleton
  • urinary
Regions:
Head and neck:
  • brain
  • cerebellum
  • head
Abdomen:
  • kidney
Limb:
  • femur
  • lower limb
  • thigh
General:
  • blood
  • blood vessel
  • coagulation system
  • peripheral nerve
  • peripheral nervous system
  • red blood cell
  • skin
  • spinal column
  • vertebrae
genes like me logo Genes that share expression patterns with AMN: view

Orthologs for AMN Gene

This gene was present in the common ancestor of animals.

Orthologs for AMN Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia AMN 34 33
  • 99.34 (n)
OneToOne
cow
(Bos Taurus)
Mammalia AMN 34 33
  • 82.85 (n)
OneToOne
rat
(Rattus norvegicus)
Mammalia Amn 33
  • 80.39 (n)
mouse
(Mus musculus)
Mammalia Amn 16 34 33
  • 72.56 (n)
oppossum
(Monodelphis domestica)
Mammalia AMN 34
  • 43 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia AMN 34
  • 42 (a)
OneToOne
dog
(Canis familiaris)
Mammalia AMN 34
  • 38 (a)
OneToOne
chicken
(Gallus gallus)
Aves AMN 34 33
  • 57.55 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia AMN 34
  • 35 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia amn 33
  • 52.85 (n)
zebrafish
(Danio rerio)
Actinopterygii amn 34 33
  • 52 (n)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta CG11592 34
  • 16 (a)
OneToOne
Species where no ortholog for AMN was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for AMN Gene

ENSEMBL:
Gene Tree for AMN (if available)
TreeFam:
Gene Tree for AMN (if available)
Aminode:
Evolutionary constrained regions (ECRs) for AMN: view image

Paralogs for AMN Gene

No data available for Paralogs for AMN Gene

Variants for AMN Gene

Sequence variations from dbSNP and Humsavar for AMN Gene

SNP ID Clin Chr 14 pos Variation AA Info Type
rs119478058 pathogenic, Megaloblastic anemia 1, Norwegian type, Recessive hereditary megaloblastic anemia 1 (RH-MGA1) [MIM:261100] 102,923,789(+) C/A/T 5_prime_UTR_variant, coding_sequence_variant, missense_variant
rs144077391 likely-pathogenic, Megaloblastic anemia due to inborn errors of metabolism 102,929,087(+) G/A/C intron_variant
rs146499374 benign, Megaloblastic anemia due to inborn errors of metabolism 102,929,723(+) A/G coding_sequence_variant, missense_variant
rs373204347 benign, Megaloblastic anemia due to inborn errors of metabolism 102,928,749(+) C/G/T intron_variant
rs386834160 likely-pathogenic, Megaloblastic anemia due to inborn errors of metabolism 102,930,096(+) CCCGCCCCATCCCGCCCCGCC/CCCGCC intron_variant

Structural Variations from Database of Genomic Variants (DGV) for AMN Gene

Variant ID Type Subtype PubMed ID
nsv1075867 CNV duplication 25765185
nsv509552 CNV insertion 20534489
nsv9167 CNV gain 18304495
nsv952256 CNV deletion 24416366

Variation tolerance for AMN Gene

Gene Damage Index Score: 3.35; 53.75% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for AMN Gene

Human Gene Mutation Database (HGMD)
AMN
SNPedia medical, phenotypic, and genealogical associations of SNPs for
AMN

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for AMN Gene

Disorders for AMN Gene

MalaCards: The human disease database

(6) MalaCards diseases for AMN Gene - From: HGMD, OMIM, ClinVar, Orphanet, Swiss-Prot, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
megaloblastic anemia 1
  • mga1
megaloblastic anemia
  • imerslund-grasbeck syndrome
vitamin b12 deficiency
  • cobalamin deficiency
congenital intrinsic factor deficiency
  • hereditary intrinsic factor deficiency
3-methylglutaconic aciduria, type i
  • mgca1
- elite association - COSMIC cancer census association via MalaCards
Search AMN in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

AMNLS_HUMAN
  • Recessive hereditary megaloblastic anemia 1 (RH-MGA1) [MIM:261100]: Due to selective malabsorption of vitamin B12. Defects in vitamin B12 absorption lead to impaired function of thymidine synthase. As a consequence DNA synthesis is interrupted. Rapidly dividing cells involved in erythropoiesis are particularly affected. {ECO:0000269 PubMed:12590260, ECO:0000269 PubMed:22631584}. Note=The disease is caused by mutations affecting the gene represented in this entry.
genes like me logo Genes that share disorders with AMN: view

No data available for Genatlas for AMN Gene

Publications for AMN Gene

  1. Amnionless, essential for mouse gastrulation, is mutated in recessive hereditary megaloblastic anemia. (PMID: 12590260) Tanner SM … de la Chapelle A (Nature genetics 2003) 3 4 22 58
  2. The amnionless gene, essential for mouse gastrulation, encodes a visceral-endoderm-specific protein with an extracellular cysteine-rich domain. (PMID: 11279523) Kalantry S … Lacy E (Nature genetics 2001) 2 3 4 58
  3. Variations of the Amnionless gene in recurrent spontaneous abortions. (PMID: 16403802) Kaare M … Aittomäki K (Molecular human reproduction 2006) 3 22 58
  4. The functional cobalamin (vitamin B12)-intrinsic factor receptor is a novel complex of cubilin and amnionless. (PMID: 14576052) Fyfe JC … Moestrup SK (Blood 2004) 3 4 58
  5. The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. (PMID: 12975309) Clark HF … Gray A (Genome research 2003) 3 4 58

Products for AMN Gene

Sources for AMN Gene

Content
Loading form....