Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SURF4 Gene

Aliases for SURF4 Gene

  • Surfeit 4 2 3 5
  • Surface 4 Integral Membrane Protein 2 3
  • Surfeit Locus Protein 4 2 3
  • SURF-4 4
  • ERV29 3

External Ids for SURF4 Gene

Previous GeneCards Identifiers for SURF4 Gene

  • GC09M127318
  • GC09M127785
  • GC09M129582
  • GC09M131504
  • GC09M133257
  • GC09M135206
  • GC09M135218
  • GC09M136228
  • GC09M105728

Summaries for SURF4 Gene

Entrez Gene Summary for SURF4 Gene

  • This gene is located in the surfeit gene cluster, which is comprised of very tightly linked housekeeping genes that do not share sequence similarity. The encoded protein is a conserved integral membrane protein that interacts with endoplasmic reticulum-Golgi intermediate compartment proteins. Disruption of this gene results in reduced numbers of endoplasmic reticulum-Golgi intermediate compartment clusters and redistribution of coat protein I to the cytosol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

GeneCards Summary for SURF4 Gene

SURF4 (Surfeit 4) is a Protein Coding gene. Among its related pathways are Innate Immune System and Golgi-to-ER retrograde transport.

UniProtKB/Swiss-Prot for SURF4 Gene

  • May play a role in the maintenance of the architecture of the endoplasmic reticulum-Golgi intermediate compartment and of the Golgi.

Gene Wiki entry for SURF4 Gene

Additional gene information for SURF4 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SURF4 Gene

Genomics for SURF4 Gene

GeneHancer (GH) Regulatory Elements for SURF4 Gene

Promoters and enhancers for SURF4 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH09J133373 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 650.7 +2.5 2477 3.1 FOXA2 ZFP64 ARID4B SIN3A DMAP1 YY1 ZNF207 ZNF143 FOS DEK STKLD1 SURF4 SURF6 GTF3C5 SURF1 LOC100130548 TSC1 WDR5 TTF1 BRD3
GH09J132977 Promoter/Enhancer 1.9 EPDnew Ensembl ENCODE dbSUPER 18.1 +399.9 399874 2 HDGF ARNT ZFP64 ARID4B SIN3A DMAP1 ZNF143 DEK SP5 REST GFI1B SETX RPL7A GTF3C5 MED22 EEF1A1P5 SURF4 TSC1 AK8 GC09P132965
GH09J133112 Promoter/Enhancer 2.9 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 10 +249.0 248977 33.8 CLOCK FEZF1 DMAP1 IRF4 YY1 SLC30A9 ZNF213 ZNF143 ZNF263 SP3 RALGDS GTF3C5 SETX BRD3 MED22 DDX31 TTF1 GTF3C4 TSC1 RPL7A
GH09J133346 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 10.1 +29.1 29132 4.5 ZFP64 DMAP1 IRF4 YY1 SLC30A9 ZNF213 ZNF143 SP3 MEF2D SSRP1 RPL7A MED22 GC09P133386 GC09P133408 GC09P133439 GC09P133440 GC09P133443 GC09P133445 PIR63017 SNORD24
GH09J132409 Promoter/Enhancer 1.9 EPDnew Ensembl ENCODE 9.9 +967.7 967710 1 ZSCAN4 ARID4B KLF17 SIN3A BMI1 KLF14 ZNF2 KLF5 ZNF48 ZNF335 LOC105376304 CFAP77 RPL7A EEF1A1P5 MED22 SURF4 SETX GTF3C5
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around SURF4 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SURF4 gene promoter:
  • Nkx2-5
  • Pax-4a
  • Lmo2
  • STAT5A
  • AML1a
  • CHOP-10
  • C/EBPalpha
  • ZID
  • HEN1

Genomic Locations for SURF4 Gene

Genomic Locations for SURF4 Gene
16,501 bases
Minus strand
14,646 bases
Minus strand

Genomic View for SURF4 Gene

Genes around SURF4 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SURF4 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SURF4 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SURF4 Gene

Proteins for SURF4 Gene

  • Protein details for SURF4 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Surfeit locus protein 4
    Protein Accession:
    Secondary Accessions:
    • B7Z6A4
    • O60923
    • Q5T8U6
    • Q9UNZ0
    • Q9UNZ1

    Protein attributes for SURF4 Gene

    269 amino acids
    Molecular mass:
    30394 Da
    Quaternary structure:
    • Found in a complex composed at least of SURF4, TMED2 and TMED10. May interact with LMAN1 (PubMed:18287528). Interacts with ZFYVE27 and with KIF5A in a ZFYVE27-dependent manner (By similarity).

    Alternative splice isoforms for SURF4 Gene


neXtProt entry for SURF4 Gene

Post-translational modifications for SURF4 Gene

  • Ubiquitination at posLast=139139
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for SURF4 Gene

Domains & Families for SURF4 Gene

Gene Families for SURF4 Gene

Human Protein Atlas (HPA):
  • Predicted membrane proteins
  • Transporters

Protein Domains for SURF4 Gene


Graphical View of Domain Structure for InterPro Entry



  • The di-lysine motif confers endoplasmic reticulum localization for type I membrane proteins.
  • Belongs to the SURF4 family.
  • The di-lysine motif confers endoplasmic reticulum localization for type I membrane proteins.
  • Belongs to the SURF4 family.
genes like me logo Genes that share domains with SURF4: view

Function for SURF4 Gene

Molecular function for SURF4 Gene

UniProtKB/Swiss-Prot Function:
May play a role in the maintenance of the architecture of the endoplasmic reticulum-Golgi intermediate compartment and of the Golgi.
GENATLAS Biochemistry:
surfeit 4 (see SURF@),putative integral membrane protein of the endoplasmic reticulum,30kDa

Phenotypes From GWAS Catalog for SURF4 Gene

Gene Ontology (GO) - Molecular Function for SURF4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 18287528
genes like me logo Genes that share ontologies with SURF4: view
genes like me logo Genes that share phenotypes with SURF4: view

Animal Model Products

CRISPR Products

miRNA for SURF4 Gene

miRTarBase miRNAs that target SURF4

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for SURF4

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for SURF4 Gene

Localization for SURF4 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SURF4 Gene

Endoplasmic reticulum membrane; Multi-pass membrane protein. Endoplasmic reticulum-Golgi intermediate compartment membrane; Multi-pass membrane protein. Golgi apparatus membrane; Multi-pass membrane protein. Note=Cycles between the endoplasmic reticulum and the Golgi. {ECO:0000269 PubMed:18287528}.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SURF4 gene
Compartment Confidence
plasma membrane 5
endoplasmic reticulum 5
golgi apparatus 5
lysosome 4

Gene Ontology (GO) - Cellular Components for SURF4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000139 Golgi membrane TAS --
GO:0005783 endoplasmic reticulum IEA --
GO:0005789 endoplasmic reticulum membrane TAS --
GO:0005793 endoplasmic reticulum-Golgi intermediate compartment IDA 15308636
GO:0005794 Golgi apparatus IEA --
genes like me logo Genes that share ontologies with SURF4: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for SURF4 Gene

Pathways & Interactions for SURF4 Gene

genes like me logo Genes that share pathways with SURF4: view

Gene Ontology (GO) - Biological Process for SURF4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006890 retrograde vesicle-mediated transport, Golgi to ER TAS --
GO:0007030 Golgi organization IMP 18287528
GO:0010638 positive regulation of organelle organization IMP 18287528
GO:0032527 NOT protein exit from endoplasmic reticulum IMP 18287528
GO:0034498 NOT early endosome to Golgi transport IMP 18287528
genes like me logo Genes that share ontologies with SURF4: view

No data available for SIGNOR curated interactions for SURF4 Gene

Drugs & Compounds for SURF4 Gene

No Compound Related Data Available

Transcripts for SURF4 Gene

Unigene Clusters for SURF4 Gene

Surfeit 4:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for SURF4

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for SURF4 Gene

ExUns: 1 ^ 2a · 2b ^ 3 ^ 4 ^ 5 ^ 6 ^ 7a · 7b · 7c · 7d ^ 8 ^ 9a · 9b · 9c ^ 10a · 10b ^ 11 ^ 12a · 12b
SP1: - - - - - - - - - - -
SP2: - - - - - - - - -
SP3: - - - - - - - -
SP4: - - - - -
SP5: - - - - - - -
SP6: - - - - - - - - -
SP7: -
SP8: - - - - - -
SP10: - - - - - -

Relevant External Links for SURF4 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SURF4 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SURF4 Gene

Protein differential expression in normal tissues from HIPED for SURF4 Gene

This gene is overexpressed in Nasal epithelium (26.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for SURF4 Gene

Protein tissue co-expression partners for SURF4 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of SURF4 Gene:


SOURCE GeneReport for Unigene cluster for SURF4 Gene:


Evidence on tissue expression from TISSUES for SURF4 Gene

  • Nervous system(5)
  • Lung(4.8)
  • Pancreas(4.2)
  • Skin(4.2)
  • Kidney(4)
  • Intestine(3.6)
  • Eye(2.9)
  • Liver(2.9)
  • Stomach(2)
genes like me logo Genes that share expression patterns with SURF4: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for SURF4 Gene

Orthologs for SURF4 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for SURF4 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia SURF4 34 33
  • 99.88 (n)
(Ornithorhynchus anatinus)
Mammalia SURF4 34
  • 97 (a)
(Monodelphis domestica)
Mammalia -- 34
  • 96 (a)
-- 34
  • 92 (a)
-- 34
  • 54 (a)
(Bos Taurus)
Mammalia SURF4 33
  • 91.33 (n)
(Canis familiaris)
Mammalia SURF4 34 33
  • 90.41 (n)
(Mus musculus)
Mammalia Surf4 16 34 33
  • 90.21 (n)
(Rattus norvegicus)
Mammalia Surf4 33
  • 89.71 (n)
(Gallus gallus)
Aves SURF4 34 33
  • 81.04 (n)
(Anolis carolinensis)
Reptilia SURF4 34
  • 80 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia surf4.2 33
  • 80.42 (n)
MGC76061 33
African clawed frog
(Xenopus laevis)
Amphibia Xl.33420 33
(Danio rerio)
Actinopterygii surf4l 34
  • 87 (a)
surf4 33
  • 79.68 (n)
zgc65806 33
fruit fly
(Drosophila melanogaster)
Insecta Surf4 34 35 33
  • 64.41 (n)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP001069 33
  • 58.52 (n)
(Caenorhabditis elegans)
Secernentea sft-4 34 35 33
  • 60.07 (n)
T02E1.7 35
  • 33 (a)
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_AGL340C 33
  • 48.54 (n)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0F03102g 33
  • 46.48 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes ERV29 36 34 33
  • 45.56 (n)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.5467 34
  • 58 (a)
Cin.3084 33
bread mold
(Neurospora crassa)
Ascomycetes NCU03319 33
  • 50.97 (n)
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes SPCC970.06 33
  • 45.8 (n)
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.3084 33
Species where no ortholog for SURF4 was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for SURF4 Gene

Gene Tree for SURF4 (if available)
Gene Tree for SURF4 (if available)
Evolutionary constrained regions (ECRs) for SURF4: view image

Paralogs for SURF4 Gene

No data available for Paralogs for SURF4 Gene

Variants for SURF4 Gene

Sequence variations from dbSNP and Humsavar for SURF4 Gene

SNP ID Clin Chr 09 pos Variation AA Info Type
rs1000027809 -- 133,375,527(-) G/A 5_prime_UTR_variant, genic_upstream_transcript_variant, intron_variant
rs1000082481 -- 133,364,756(-) CAGGGAGGGGTGAGCAGGGAGGGG/CAGGGAGGGG intron_variant
rs1000094615 -- 133,374,372(-) G/C genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1000492737 -- 133,369,743(-) A/G intron_variant
rs1000672464 -- 133,373,130(-) G/A 5_prime_UTR_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for SURF4 Gene

Variant ID Type Subtype PubMed ID
esv2739138 CNV deletion 23290073
nsv1125319 OTHER inversion 24896259

Variation tolerance for SURF4 Gene

Residual Variation Intolerance Score: 31.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.48; 10.52% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for SURF4 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SURF4 Gene

Disorders for SURF4 Gene

Additional Disease Information for SURF4

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology

No disorders were found for SURF4 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SURF4 Gene

Publications for SURF4 Gene

  1. The surf-4 gene encodes a novel 30 kDa integral membrane protein. (PMID: 7540914) Reeves JE … Fried M (Molecular membrane biology 1995) 2 3 4 58
  2. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose JE … Uhl GR (Molecular medicine (Cambridge, Mass.) 2010) 3 44 58
  3. Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PMID: 20628086) Bailey SD … DREAM investigators (Diabetes care 2010) 3 44 58
  4. The cargo receptors Surf4, endoplasmic reticulum-Golgi intermediate compartment (ERGIC)-53, and p25 are required to maintain the architecture of ERGIC and Golgi. (PMID: 18287528) Mitrovic S … Hauri HP (Molecular biology of the cell 2008) 3 4 58
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58

Products for SURF4 Gene

Sources for SURF4 Gene

Loading form....