Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SOX3 Gene

Aliases for SOX3 Gene

  • SRY-Box 3 2 3 5
  • SRY (Sex Determining Region Y)-Box 3 2 3
  • Transcription Factor SOX-3 3
  • Panhypopituitarism 2
  • SRY Box 3 2
  • GHDX 3
  • MRGH 3
  • PHPX 3
  • SOXB 3
  • PHP 3

External Ids for SOX3 Gene

Previous HGNC Symbols for SOX3 Gene

  • PHP

Previous GeneCards Identifiers for SOX3 Gene

  • GC0XM134169
  • GC0XM136443
  • GC0XM137530
  • GC0XM138290
  • GC0XM139310
  • GC0XM139412
  • GC0XM139585
  • GC0XM128852

Summaries for SOX3 Gene

Entrez Gene Summary for SOX3 Gene

  • This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. Mutations in this gene have been associated with X-linked cognitive disability with growth hormone deficiency. [provided by RefSeq, Jul 2008]

GeneCards Summary for SOX3 Gene

SOX3 (SRY-Box 3) is a Protein Coding gene. Diseases associated with SOX3 include Mental Retardation, X-Linked, With Panhypopituitarism and Panhypopituitarism, X-Linked. Among its related pathways are ERK Signaling and Signaling by GPCR. Gene Ontology (GO) annotations related to this gene include DNA binding transcription factor activity and RNA polymerase II transcription corepressor activity. An important paralog of this gene is SOX1.

UniProtKB/Swiss-Prot for SOX3 Gene

  • Transcription factor required during the formation of the hypothalamo-pituitary axis. May function as a switch in neuronal development. Keeps neural cells undifferentiated by counteracting the activity of proneural proteins and suppresses neuronal differentiation. Required also within the pharyngeal epithelia for craniofacial morphogenesis. Controls a genetic switch in male development. Is necessary for initiating male sex determination by directing the development of supporting cell precursors (pre-Sertoli cells) as Sertoli rather than granulosa cells (By similarity).

Gene Wiki entry for SOX3 Gene

Additional gene information for SOX3 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SOX3 Gene

Genomics for SOX3 Gene

GeneHancer (GH) Regulatory Elements for SOX3 Gene

Promoters and enhancers for SOX3 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH0XI140506 Promoter/Enhancer 0.9 EPDnew ENCODE 550.8 0.0 -46 0.2 POLR2A EZH2 GC0XM140504 SOX3 LOC105373344
GH0XI140505 Promoter 0.7 EPDnew 550.8 -0.4 -350 0.1 ZBTB48 EZH2 GC0XM140504 SOX3 LOC105373344
GH0XI140503 Enhancer 0.5 Ensembl 550.8 +1.4 1415 0.2 E2F1 ZBTB26 ZFX EZH2 GC0XM140504 SOX3 RPS17P17
GH0XI140504 Enhancer 0.5 Ensembl 550.8 +0.9 915 0.4 E2F1 CTCF MXI1 ZBTB26 ZFX EZH2 GC0XM140504 SOX3 RPS17P17
GH0XI140509 Enhancer 0.4 ENCODE 550.8 -0.5 -455 0.2 ZBTB48 ZBTB20 EZH2 GC0XM140504 SOX3 LOC105373344
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SOX3 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SOX3 gene promoter:

Genomic Locations for SOX3 Gene

Genomic Locations for SOX3 Gene
2,132 bases
Minus strand

Genomic View for SOX3 Gene

Genes around SOX3 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SOX3 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SOX3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SOX3 Gene

Proteins for SOX3 Gene

  • Protein details for SOX3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Transcription factor SOX-3
    Protein Accession:
    Secondary Accessions:
    • P35714
    • Q5JWI3
    • Q9NP49

    Protein attributes for SOX3 Gene

    446 amino acids
    Molecular mass:
    45210 Da
    Quaternary structure:
    • Interacts with SOX2 and FGFR1.

neXtProt entry for SOX3 Gene

Post-translational modifications for SOX3 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for SOX3 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for SOX3 Gene

Domains & Families for SOX3 Gene

Gene Families for SOX3 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins
  • Transcription factors

Protein Domains for SOX3 Gene

Suggested Antigen Peptide Sequences for SOX3 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with SOX3: view

No data available for UniProtKB/Swiss-Prot for SOX3 Gene

Function for SOX3 Gene

Molecular function for SOX3 Gene

GENATLAS Biochemistry:
SRY related HMG box gene 3,found in human fetal brain and spinal cord,deleted in a male patient with hemophilia and mental retardation (and testicular failure),modulator of LINE retroposons promoter activity
UniProtKB/Swiss-Prot Function:
Transcription factor required during the formation of the hypothalamo-pituitary axis. May function as a switch in neuronal development. Keeps neural cells undifferentiated by counteracting the activity of proneural proteins and suppresses neuronal differentiation. Required also within the pharyngeal epithelia for craniofacial morphogenesis. Controls a genetic switch in male development. Is necessary for initiating male sex determination by directing the development of supporting cell precursors (pre-Sertoli cells) as Sertoli rather than granulosa cells (By similarity).

Gene Ontology (GO) - Molecular Function for SOX3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000979 RNA polymerase II core promoter sequence-specific DNA binding ISS --
GO:0001106 RNA polymerase II transcription corepressor activity ISS --
GO:0003677 DNA binding TAS 8625802
genes like me logo Genes that share ontologies with SOX3: view
genes like me logo Genes that share phenotypes with SOX3: view

Human Phenotype Ontology for SOX3 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for SOX3 Gene

MGI Knock Outs for SOX3:
Targeted motifs for SOX3 Gene
HOMER Transcription Factor Regulatory Elements motif SOX3
  • Consensus sequence: CCWTTGTY Submotif: canonical Cell Type: NPC GEO ID: GSE33059

Clone Products

  • Addgene plasmids for SOX3

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog and Transcription Factor Targets for SOX3 Gene

Localization for SOX3 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SOX3 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SOX3 gene
Compartment Confidence
nucleus 5
mitochondrion 2
extracellular 1
peroxisome 1
cytosol 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for SOX3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA --
GO:0005654 nucleoplasm TAS --
genes like me logo Genes that share ontologies with SOX3: view

Pathways & Interactions for SOX3 Gene

genes like me logo Genes that share pathways with SOX3: view

SIGNOR curated interactions for SOX3 Gene


Gene Ontology (GO) - Biological Process for SOX3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription by RNA polymerase II IEA --
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0007275 multicellular organism development IEA --
GO:0007417 central nervous system development TAS 8625802
genes like me logo Genes that share ontologies with SOX3: view

Drugs & Compounds for SOX3 Gene

(1) Drugs for SOX3 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
genes like me logo Genes that share compounds with SOX3: view

Transcripts for SOX3 Gene

mRNA/cDNA for SOX3 Gene

(1) REFSEQ mRNAs :
(5) Additional mRNA sequences :
(10) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for SOX3 Gene

SRY (sex determining region Y)-box 3:
Representative Sequences:

Clone Products

  • Addgene plasmids for SOX3

Alternative Splicing Database (ASD) splice patterns (SP) for SOX3 Gene

No ASD Table

Relevant External Links for SOX3 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SOX3 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SOX3 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for SOX3 Gene

This gene is overexpressed in Testis (x7.2), Brain - Hypothalamus (x6.4), and Pituitary (x5.3).

Protein differential expression in normal tissues from HIPED for SOX3 Gene

This gene is overexpressed in Brain (68.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for SOX3 Gene

Protein tissue co-expression partners for SOX3 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of SOX3 Gene:


SOURCE GeneReport for Unigene cluster for SOX3 Gene:


Evidence on tissue expression from TISSUES for SOX3 Gene

  • Nervous system(4.5)

Phenotype-based relationships between genes and organs from Gene ORGANizer for SOX3 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • cardiovascular
  • digestive
  • endocrine
  • immune
  • integumentary
  • lymphatic
  • nervous
  • reproductive
  • respiratory
  • skeletal muscle
  • skeleton
  • urinary
Head and neck:
  • brain
  • cranial nerve
  • ear
  • eye
  • face
  • head
  • hypothalamus
  • mouth
  • neck
  • pituitary gland
  • skull
  • thyroid
  • breast
  • esophagus
  • heart
  • lung
  • adrenal gland
  • intestine
  • large intestine
  • small intestine
  • spleen
  • stomach
  • fallopian tube
  • ovary
  • pelvis
  • penis
  • prostate
  • testicle
  • urethra
  • urinary bladder
  • uterus
  • vagina
  • vas deferens
  • vulva
  • digit
  • finger
  • foot
  • hand
  • lower limb
  • toe
  • upper limb
  • blood
  • blood vessel
  • coagulation system
  • hair
  • lymph node
  • peripheral nerve
  • peripheral nervous system
  • red blood cell
  • skin
  • spinal cord
  • white blood cell
genes like me logo Genes that share expression patterns with SOX3: view

No data available for mRNA Expression by UniProt/SwissProt for SOX3 Gene

Orthologs for SOX3 Gene

This gene was present in the common ancestor of animals.

Orthologs for SOX3 Gene

Organism Taxonomy Gene Similarity Type Details
(Canis familiaris)
Mammalia SOX3 33 34
  • 90.99 (n)
(Mus musculus)
Mammalia Sox3 33 16 34
  • 89.81 (n)
(Monodelphis domestica)
Mammalia SOX3 34
  • 89 (a)
(Ornithorhynchus anatinus)
Mammalia SOX3 34
  • 77 (a)
(Gallus gallus)
Aves SOX3 33
  • 74.79 (n)
tropical clawed frog
(Silurana tropicalis)
Amphibia sox3 33
  • 72.79 (n)
Str.8109 33
African clawed frog
(Xenopus laevis)
Amphibia Xl.22 33
(Danio rerio)
Actinopterygii sox3 33 34
  • 74.66 (n)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.3413 33
fruit fly
(Drosophila melanogaster)
Insecta Sox21a 35
  • 86 (a)
D 35
  • 78 (a)
Sox21b 35
  • 63 (a)
SoxN 34
  • 29 (a)
(Caenorhabditis elegans)
Secernentea sox-2 34
  • 36 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 34 (a)
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.10093 33
Species where no ortholog for SOX3 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chimpanzee (Pan troglodytes)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • cow (Bos Taurus)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for SOX3 Gene

Gene Tree for SOX3 (if available)
Gene Tree for SOX3 (if available)

Paralogs for SOX3 Gene

(5) SIMAP similar genes for SOX3 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with SOX3: view

Variants for SOX3 Gene

Sequence variations from dbSNP and Humsavar for SOX3 Gene

SNP ID Clin Chr 0X pos Variation AA Info Type
rs112180170 likely-benign, benign, not specified, not provided 140,505,047(-) C/G/T coding_sequence_variant, missense_variant
rs200361128 likely-benign, likely-pathogenic, not specified, Abnormality of brain morphology 140,504,904(-) C/G coding_sequence_variant, missense_variant
rs201101913 benign, not specified, not provided 140,504,754(-) G/T coding_sequence_variant, missense_variant
rs73637709 benign, not specified, not provided 140,504,934(-) C/G/T coding_sequence_variant, missense_variant
rs748467720 likely-benign, not specified 140,504,324(-) GCGGCTGCGGCCGCGGCAGCGGCGGC/GCGGC coding_sequence_variant, inframe_deletion

Structural Variations from Database of Genomic Variants (DGV) for SOX3 Gene

Variant ID Type Subtype PubMed ID
nsv1075334 CNV deletion 25765185

Variation tolerance for SOX3 Gene

Gene Damage Index Score: 2.57; 44.66% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for SOX3 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SOX3 Gene

Disorders for SOX3 Gene

MalaCards: The human disease database

(18) MalaCards diseases for SOX3 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search SOX3 in MalaCards View complete list of genes associated with diseases


  • 46,XX sex reversal 3 (SRXX3) [MIM:300833]: A condition in which male gonads develop in a genetic female (female to male sex reversal). {ECO:0000269 PubMed:21183788}. Note=The disease is caused by mutations affecting the gene represented in this entry. Copy number variations (CNV) encompassing or in close proximity to SOX3 are responsible for XX male reversal. These variations include two duplications of approximately 123 kb and 85 kb, the former of which spans the entire SOX3 gene; a 343 kb deletion immediately upstream of SOX3 that is probably responsible of altered regulation (and not increased dosage) of SOX3; a large (approximately 6 Mb) duplication that encompasses SOX3 and at least 18 additional distally located genes. Its proximal breakpoint falls within the SOX3 regulatory region. This large rearrangement has been found in a patient with XX male reversal and a complex phenotype that also includes a scrotal hypoplasia, microcephaly, developmental delay, and growth retardation.
  • Mental retardation, X-linked, with isolated growth hormone deficiency (MRXGH) [MIM:300123]: A disorder characterized by the association of variable degrees of mental retardation with panhypopituitarism, variable combinations of hypothyroidism, delayed pubertal development, and short stature due to growth hormone deficiency. {ECO:0000269 PubMed:12428212}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Panhypopituitarism X-linked (PHPX) [MIM:312000]: Affected individuals have absent infundibulum, anterior pituitary hypoplasia, and ectopic posterior pituitary. {ECO:0000269 PubMed:15800844}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for SOX3

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with SOX3: view

No data available for Genatlas for SOX3 Gene

Publications for SOX3 Gene

  1. Over- and underdosage of SOX3 is associated with infundibular hypoplasia and hypopituitarism. (PMID: 15800844) Woods KS … Dattani MT (American journal of human genetics 2005) 2 3 4 22 58
  2. Transcription factor SOX3 is involved in X-linked mental retardation with growth hormone deficiency. (PMID: 12428212) Laumonnier F … Briault S (American journal of human genetics 2002) 3 4 22 58
  3. SOX3 is an X-linked gene related to SRY. (PMID: 8111369) Stevanović M … Goodfellow PN (Human molecular genetics 1993) 3 4 22 58
  4. Identification of SOX3 as an XX male sex reversal gene in mice and humans. (PMID: 21183788) Sutton E … Thomas P (The Journal of clinical investigation 2011) 3 4 58
  5. The male-determining gene SRY is a hybrid of DGCR8 and SOX3, and is regulated by the transcription factor CP2. (PMID: 19902333) Sato Y … Nakahori Y (Molecular and cellular biochemistry 2010) 3 22 58

Products for SOX3 Gene

  • Addgene plasmids for SOX3

Sources for SOX3 Gene

Loading form....