Free for academic non-profit institutions. Other users need a Commercial license

Aliases for MRPL40 Gene

Aliases for MRPL40 Gene

  • Mitochondrial Ribosomal Protein L40 2 3 5
  • Nuclear Localization Signal-Containing Protein Deleted In Velocardiofacial Syndrome 3 4
  • Mitochondrial Large Ribosomal Subunit Protein ML40 3 4
  • Up-Regulated In Metastasis 3 4
  • MRP-L40 3 4
  • NLVCF 3 4
  • L40mt 3 4
  • URIM 3 4
  • Nuclear Localization Signal Deleted In Velocardiofacial Syndrome 2
  • 39S Ribosomal Protein L40, Mitochondrial 3
  • MRP-L22 3
  • MRPL22 3

External Ids for MRPL40 Gene

Previous HGNC Symbols for MRPL40 Gene

  • NLVCF

Previous GeneCards Identifiers for MRPL40 Gene

  • GC22U990205
  • GC22P016361
  • GC22P017794
  • GC22P017793
  • GC22P003040

Summaries for MRPL40 Gene

Entrez Gene Summary for MRPL40 Gene

  • Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Deletions in this gene may contribute to the etiology of velo-cardio-facial syndrome and DiGeorge syndrome. [provided by RefSeq, Jul 2008]

GeneCards Summary for MRPL40 Gene

MRPL40 (Mitochondrial Ribosomal Protein L40) is a Protein Coding gene. Diseases associated with MRPL40 include Velocardiofacial Syndrome. Among its related pathways are Organelle biogenesis and maintenance and Mitochondrial translation.

Gene Wiki entry for MRPL40 Gene

Additional gene information for MRPL40 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for MRPL40 Gene

Genomics for MRPL40 Gene

GeneHancer (GH) Regulatory Elements for MRPL40 Gene

Promoters and enhancers for MRPL40 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH22J019429 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 659.3 -0.1 -128 4.7 CLOCK MLX ZFP64 DMAP1 IRF4 YY1 SLC30A9 E2F8 ZNF143 ZNF263 MRPL40 HIRA TRMT2A DGCR8 UFD1 LINC01311 RPL7AP70 ENSG00000273300 RPL8P5 ESS2
GH22J019463 Enhancer 0.6 ENCODE 11.7 +32.1 32120 1.8 SMARCE1 HNRNPUL1 GTF2E2 JUN ASH1L TSC22D4 NFXL1 FOSL1 MBD2 GATA3 UFD1 RPL7AP70 DGCR11 MRPL40 CLTCL1 TSSK2 TSSK1A DGCR2 ENSG00000223461 ENSG00000273212
GH22J019418 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 0.4 -10.8 -10798 6.2 HDGF HNRNPUL1 PKNOX1 SMAD1 ARNT IRF4 YY1 POLR2B ZNF766 E2F8 UFD1 TRMT2A DGCR8 RPL7AP70 DGCR11 RPL8P5 ENSG00000273300 LINC01311 RANBP1 ESS2
GH22J019396 Enhancer 1.2 ENCODE dbSUPER 0.3 -34.2 -34217 2.1 HDGF PKNOX1 SMAD1 ATF1 ARNT YY1 TCF12 ZNF766 CBX5 GATA2 DGCR8 TRMT2A UFD1 RPL8P5 ENSG00000273300 E2F6P1 HIRA C22orf39 LOC105372860 LINC01311
GH22J019428 Enhancer 0.5 Ensembl 0.7 -3.1 -3101 0.4 BCOR ZNF282 ZNF121 ZNF316 MAFG ZMYM3 MAFK MRPL40 C22orf39 HIRA RN7SL168P
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around MRPL40 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the MRPL40 gene promoter:
  • TBP
  • AML1a
  • Ik-2
  • USF-1
  • USF-1:USF-2
  • USF1
  • USF2
  • AREB6
  • MAZR
  • E47

Genomic Locations for MRPL40 Gene

Genomic Locations for MRPL40 Gene
chr22:19,431,902-19,436,077
(GRCh38/hg38)
Size:
4,176 bases
Orientation:
Plus strand
chr22:19,419,425-19,423,598
(GRCh37/hg19)
Size:
4,174 bases
Orientation:
Plus strand

Genomic View for MRPL40 Gene

Genes around MRPL40 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
MRPL40 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for MRPL40 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for MRPL40 Gene

Proteins for MRPL40 Gene

  • Protein details for MRPL40 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9NQ50-RM40_HUMAN
    Recommended name:
    39S ribosomal protein L40, mitochondrial
    Protein Accession:
    Q9NQ50
    Secondary Accessions:
    • B3KVZ7
    • O95134

    Protein attributes for MRPL40 Gene

    Size:
    206 amino acids
    Molecular mass:
    24490 Da
    Quaternary structure:
    • Component of the mitochondrial large ribosomal subunit (mt-LSU). Mature mammalian 55S mitochondrial ribosomes consist of a small (28S) and a large (39S) subunit. The 28S small subunit contains a 12S ribosomal RNA (12S mt-rRNA) and 30 different proteins. The 39S large subunit contains a 16S rRNA (16S mt-rRNA), a copy of mitochondrial valine transfer RNA (mt-tRNA(Val)), which plays an integral structural role, and 52 different proteins. mL40 binds to the major groove of the anticodon stem of mt-tRNA(Val) in the central protubernace.

    Three dimensional structures from OCA and Proteopedia for MRPL40 Gene

neXtProt entry for MRPL40 Gene

Post-translational modifications for MRPL40 Gene

  • Ubiquitination at Lys77
  • Modification sites at PhosphoSitePlus

Other Protein References for MRPL40 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for MRPL40 Gene

Domains & Families for MRPL40 Gene

Gene Families for MRPL40 Gene

HGNC:
Human Protein Atlas (HPA):
  • Plasma proteins
  • Predicted intracellular proteins
  • Ribosomal proteins

Protein Domains for MRPL40 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for MRPL40 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q9NQ50

UniProtKB/Swiss-Prot:

RM40_HUMAN :
  • Belongs to the mitochondrion-specific ribosomal protein mL40 family.
Family:
  • Belongs to the mitochondrion-specific ribosomal protein mL40 family.
genes like me logo Genes that share domains with MRPL40: view

Function for MRPL40 Gene

Gene Ontology (GO) - Molecular Function for MRPL40 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003723 RNA binding HDA 22681889
GO:0005515 protein binding IPI 25416956
genes like me logo Genes that share ontologies with MRPL40: view
genes like me logo Genes that share phenotypes with MRPL40: view

Animal Model Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for MRPL40 Gene

Localization for MRPL40 Gene

Subcellular locations from UniProtKB/Swiss-Prot for MRPL40 Gene

Mitochondrion.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for MRPL40 gene
Compartment Confidence
mitochondrion 5
nucleus 5
cytosol 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Mitochondria (4)
  • Nucleoli (4)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for MRPL40 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus TAS 9790763
GO:0005739 mitochondrion IEA --
GO:0005743 mitochondrial inner membrane TAS --
GO:0005761 mitochondrial ribosome IEA,ISS --
GO:0005762 mitochondrial large ribosomal subunit IDA 25278503
genes like me logo Genes that share ontologies with MRPL40: view

Pathways & Interactions for MRPL40 Gene

genes like me logo Genes that share pathways with MRPL40: view

Gene Ontology (GO) - Biological Process for MRPL40 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0009653 anatomical structure morphogenesis TAS 9790763
GO:0070125 mitochondrial translational elongation TAS --
GO:0070126 mitochondrial translational termination TAS --
genes like me logo Genes that share ontologies with MRPL40: view

No data available for SIGNOR curated interactions for MRPL40 Gene

Drugs & Compounds for MRPL40 Gene

No Compound Related Data Available

Transcripts for MRPL40 Gene

mRNA/cDNA for MRPL40 Gene

Unigene Clusters for MRPL40 Gene

Mitochondrial ribosomal protein L40:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for MRPL40 Gene

ExUns: 1a · 1b · 1c ^ 2a · 2b ^ 3a · 3b ^ 4a · 4b · 4c · 4d
SP1: - - -
SP2: - -
SP3:
SP4: -

Relevant External Links for MRPL40 Gene

GeneLoc Exon Structure for
MRPL40
ECgene alternative splicing isoforms for
MRPL40

Expression for MRPL40 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for MRPL40 Gene

Protein differential expression in normal tissues from HIPED for MRPL40 Gene

This gene is overexpressed in Bone (18.8) and Pancreas (12.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for MRPL40 Gene



Protein tissue co-expression partners for MRPL40 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of MRPL40 Gene:

MRPL40

SOURCE GeneReport for Unigene cluster for MRPL40 Gene:

Hs.431307

mRNA Expression by UniProt/SwissProt for MRPL40 Gene:

Q9NQ50-RM40_HUMAN
Tissue specificity: Ubiquitous.

Evidence on tissue expression from TISSUES for MRPL40 Gene

  • Lung(4.3)
  • Liver(2.2)
  • Nervous system(2.2)
  • Heart(2.1)
  • Muscle(2.1)
genes like me logo Genes that share expression patterns with MRPL40: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for MRPL40 Gene

Orthologs for MRPL40 Gene

This gene was present in the common ancestor of animals.

Orthologs for MRPL40 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia MRPL40 34 33
  • 99.19 (n)
OneToOne
dog
(Canis familiaris)
Mammalia MRPL40 33
  • 82.2 (n)
rat
(Rattus norvegicus)
Mammalia Mrpl40 33
  • 80.42 (n)
mouse
(Mus musculus)
Mammalia Mrpl40 16 34 33
  • 80.26 (n)
cow
(Bos Taurus)
Mammalia MRPL40 34 33
  • 78.18 (n)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia MRPL40 34
  • 62 (a)
OneToOne
chicken
(Gallus gallus)
Aves MRPL40 34 33
  • 66.9 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia aca-mir-5408a 34
  • 52 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia mrpl40 33
  • 60.31 (n)
zebrafish
(Danio rerio)
Actinopterygii mrpl40 34 33
  • 55.5 (n)
OneToOne
wufj54c06 33
fruit fly
(Drosophila melanogaster)
Insecta mRpL40 34 33
  • 53.12 (n)
OneToOne
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP000110 33
  • 49.52 (n)
worm
(Caenorhabditis elegans)
Secernentea mrpl-40 34 33
  • 48.77 (n)
OneToOne
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 24 (a)
OneToOne
Species where no ortholog for MRPL40 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for MRPL40 Gene

ENSEMBL:
Gene Tree for MRPL40 (if available)
TreeFam:
Gene Tree for MRPL40 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for MRPL40: view image

Paralogs for MRPL40 Gene

Pseudogenes.org Pseudogenes for MRPL40 Gene

genes like me logo Genes that share paralogs with MRPL40: view

No data available for Paralogs for MRPL40 Gene

Variants for MRPL40 Gene

Sequence variations from dbSNP and Humsavar for MRPL40 Gene

SNP ID Clin Chr 22 pos Variation AA Info Type
rs1000249912 -- 19,432,446(+) A/T 5_prime_UTR_variant, genic_upstream_transcript_variant, upstream_transcript_variant
rs1000967157 -- 19,434,847(+) T/C coding_sequence_variant, synonymous_variant
rs1001176245 -- 19,430,130(+) A/G upstream_transcript_variant
rs1001704390 -- 19,430,797(+) T/C upstream_transcript_variant
rs1001933722 -- 19,431,642(+) GCCGCCACAGCCGCCAC/GCCGCCACAGCCGCCACAGCCGCCAC upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for MRPL40 Gene

Variant ID Type Subtype PubMed ID
esv2751940 CNV gain 17911159
esv3575418 CNV gain 25503493
nsv588216 CNV gain 21841781
nsv834124 CNV loss 17160897
nsv834127 CNV loss 17160897

Variation tolerance for MRPL40 Gene

Residual Variation Intolerance Score: 67.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 7.87; 83.67% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for MRPL40 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
MRPL40

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for MRPL40 Gene

Disorders for MRPL40 Gene

MalaCards: The human disease database

(1) MalaCards diseases for MRPL40 Gene - From: DISEASES and GeneCards

Disorder Aliases PubMed IDs
velocardiofacial syndrome
  • cayler cardiofacial syndrome
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for MRPL40

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with MRPL40: view

No data available for UniProtKB/Swiss-Prot and Genatlas for MRPL40 Gene

Publications for MRPL40 Gene

  1. Isolation and characterization of a human gene containing a nuclear localization signal from the critical region for velo-cardio-facial syndrome on 22q11. (PMID: 9790763) Funke B … Morrow B (Genomics 1998) 2 3 4 58
  2. Structure of the large ribosomal subunit from human mitochondria. (PMID: 25278503) Brown A … Ramakrishnan V (Science (New York, N.Y.) 2014) 3 4 58
  3. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression. (PMID: 20877624) Hendrickson SL … O'Brien SJ (PloS one 2010) 3 44 58
  4. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  5. A genome annotation-driven approach to cloning the human ORFeome. (PMID: 15461802) Collins JE … Dunham I (Genome biology 2004) 3 4 58

Products for MRPL40 Gene

Sources for MRPL40 Gene

Content
Loading form....