Free for academic non-profit institutions. Other users need a Commercial license

Aliases for GLRX5 Gene

Aliases for GLRX5 Gene

  • Glutaredoxin 5 2 3 5
  • Monothiol Glutaredoxin-5 3 4
  • C14orf87 3 4
  • Glutaredoxin-Related Protein 5, Mitochondrial 3
  • Glutaredoxin 5 Homolog (S. Cerevisiae) 2
  • Chromosome 14 Open Reading Frame 87 2
  • Glutaredoxin 5 Homolog 3
  • FLB4739 3
  • PR01238 3
  • PRO1238 3
  • SIDBA3 3
  • SPAHGC 3
  • GRX5 3
  • PRSA 3

External Ids for GLRX5 Gene

Previous HGNC Symbols for GLRX5 Gene

  • C14orf87

Previous GeneCards Identifiers for GLRX5 Gene

  • GC14P095072
  • GC14P096001
  • GC14P076186

Summaries for GLRX5 Gene

Entrez Gene Summary for GLRX5 Gene

  • This gene encodes a mitochondrial protein, which is evolutionarily conserved. It is involved in the biogenesis of iron-sulfur clusters, which are required for normal iron homeostasis. Mutations in this gene are associated with autosomal recessive pyridoxine-refractory sideroblastic anemia. [provided by RefSeq, May 2010]

GeneCards Summary for GLRX5 Gene

GLRX5 (Glutaredoxin 5) is a Protein Coding gene. Diseases associated with GLRX5 include Anemia, Sideroblastic, 3, Pyridoxine-Refractory and Spasticity, Childhood-Onset, With Hyperglycinemia. Among its related pathways are PAK Pathway. Gene Ontology (GO) annotations related to this gene include electron transfer activity and 2 iron, 2 sulfur cluster binding.

UniProtKB/Swiss-Prot for GLRX5 Gene

  • Monothiol glutaredoxin involved in the biogenesis of iron-sulfur clusters (PubMed:20364084). Involved in protein lipoylation, acting in the pathway that provides an iron-sulfur cluster to lipoate synthase (PubMed:24334290). Required for normal iron homeostasis. Required for normal regulation of hemoglobin synthesis by the iron-sulfur protein ACO1 (PubMed:20364084). May protect cells against apoptosis due to reactive oxygen species and oxidative stress (By similarity).

Gene Wiki entry for GLRX5 Gene

Additional gene information for GLRX5 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for GLRX5 Gene

Genomics for GLRX5 Gene

GeneHancer (GH) Regulatory Elements for GLRX5 Gene

Promoters and enhancers for GLRX5 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH14J095530 Promoter/Enhancer 2.5 EPDnew Ensembl ENCODE dbSUPER 669.8 +1.4 1372 8.8 CLOCK MLX DMAP1 IRF4 YY1 ZNF213 E2F8 ZNF143 SP3 NFYC GLRX5 SCARNA13 SNHG10 GC14M095530 GC14M095534 SYNE3 PAPOLA LOC101929107 DICER1
GH14J095543 Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 21.8 +12.8 12784 5.4 ATF1 FOXA2 ARID4B NEUROD1 ZNF48 TCF12 ZNF766 GATA2 ATF7 FOS GLRX5 LOC101929107 TCL6 GC14M095530 LINC02318
GH14J095522 Enhancer 1.4 Ensembl ENCODE dbSUPER 19.1 -8.4 -8402 6 FOXA2 MLX ZFP64 ARID4B DMAP1 YY1 SLC30A9 POLR2B ZNF766 ZNF143 GLRX5 LOC101929107 SNHG10 PAPOLA SYNE3
GH14J095513 Promoter/Enhancer 2.4 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 7 -16.2 -16245 6.9 HDGF PKNOX1 ARID4B SIN3A FEZF1 IRF4 GLIS2 ZNF207 ZNF143 ATF7 LOC101929107 SYNE3 GLRX5
GH14J095542 Enhancer 0.4 ENCODE 21.5 +9.5 9521 0.4 FOXA2 FOXA1 GLRX5 GC14M095530 LINC02318
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around GLRX5 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the GLRX5 gene promoter:
  • AREB6
  • Nkx2-5
  • POU2F1a
  • POU2F1
  • AML1a
  • Pax-5
  • Nkx5-1
  • GR-beta
  • GR-alpha
  • GR

Genomic Locations for GLRX5 Gene

Genomic Locations for GLRX5 Gene
11,222 bases
Plus strand
11,222 bases
Plus strand

Genomic View for GLRX5 Gene

Genes around GLRX5 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
GLRX5 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for GLRX5 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for GLRX5 Gene

Proteins for GLRX5 Gene

  • Protein details for GLRX5 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Glutaredoxin-related protein 5, mitochondrial
    Protein Accession:
    Secondary Accessions:
    • Q0X088
    • Q3YML0
    • Q86WY3
    • Q8IZ54

    Protein attributes for GLRX5 Gene

    157 amino acids
    Molecular mass:
    16628 Da
    Quaternary structure:
    • Homodimer (PubMed:21029046). Interacts with ISCU (PubMed:26100117). Interacts with BOLA1 (PubMed:27532773, PubMed:27532772).
    • Sequence=CAD62364.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for GLRX5 Gene

neXtProt entry for GLRX5 Gene

Post-translational modifications for GLRX5 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for GLRX5 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for GLRX5 Gene

Domains & Families for GLRX5 Gene

Gene Families for GLRX5 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for GLRX5 Gene

Suggested Antigen Peptide Sequences for GLRX5 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the glutaredoxin family. Monothiol subfamily.
  • Belongs to the glutaredoxin family. Monothiol subfamily.
genes like me logo Genes that share domains with GLRX5: view

Function for GLRX5 Gene

Molecular function for GLRX5 Gene

UniProtKB/Swiss-Prot Function:
Monothiol glutaredoxin involved in the biogenesis of iron-sulfur clusters (PubMed:20364084). Involved in protein lipoylation, acting in the pathway that provides an iron-sulfur cluster to lipoate synthase (PubMed:24334290). Required for normal iron homeostasis. Required for normal regulation of hemoglobin synthesis by the iron-sulfur protein ACO1 (PubMed:20364084). May protect cells against apoptosis due to reactive oxygen species and oxidative stress (By similarity).

Phenotypes From GWAS Catalog for GLRX5 Gene

Gene Ontology (GO) - Molecular Function for GLRX5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 24606901
GO:0009055 electron transfer activity IEA --
GO:0015035 protein disulfide oxidoreductase activity IEA --
GO:0015036 disulfide oxidoreductase activity IEA --
GO:0046872 metal ion binding IEA --
genes like me logo Genes that share ontologies with GLRX5: view
genes like me logo Genes that share phenotypes with GLRX5: view

Human Phenotype Ontology for GLRX5 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for GLRX5

Clone Products

  • Addgene plasmids for GLRX5

No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for GLRX5 Gene

Localization for GLRX5 Gene

Subcellular locations from UniProtKB/Swiss-Prot for GLRX5 Gene

Mitochondrion matrix.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for GLRX5 gene
Compartment Confidence
mitochondrion 5
nucleus 3
cytosol 3

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for GLRX5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA --
GO:0005739 mitochondrion ISS --
GO:0005759 mitochondrial matrix TAS --
GO:0030425 dendrite IEA --
GO:0043025 neuronal cell body IEA --
genes like me logo Genes that share ontologies with GLRX5: view

Pathways & Interactions for GLRX5 Gene

SuperPathways for GLRX5 Gene

SuperPathway Contained pathways
1 PAK Pathway
genes like me logo Genes that share pathways with GLRX5: view

Pathways by source for GLRX5 Gene

1 Qiagen pathway for GLRX5 Gene

Gene Ontology (GO) - Biological Process for GLRX5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0009249 protein lipoylation IMP 24334290
GO:0022900 electron transport chain IEA --
GO:0030097 hemopoiesis ISS --
GO:0044281 small molecule metabolic process TAS --
GO:0045454 cell redox homeostasis IEA --
genes like me logo Genes that share ontologies with GLRX5: view

No data available for SIGNOR curated interactions for GLRX5 Gene

Drugs & Compounds for GLRX5 Gene

No Compound Related Data Available

Transcripts for GLRX5 Gene

mRNA/cDNA for GLRX5 Gene

(1) REFSEQ mRNAs :
(9) Additional mRNA sequences :
(155) Selected AceView cDNA sequences:
(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for GLRX5 Gene

Glutaredoxin 5:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for GLRX5

Clone Products

  • Addgene plasmids for GLRX5

Alternative Splicing Database (ASD) splice patterns (SP) for GLRX5 Gene

No ASD Table

Relevant External Links for GLRX5 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for GLRX5 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for GLRX5 Gene

Protein differential expression in normal tissues from HIPED for GLRX5 Gene

This gene is overexpressed in Peripheral blood mononuclear cells (8.1) and Adrenal (7.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for GLRX5 Gene

Protein tissue co-expression partners for GLRX5 Gene

NURSA nuclear receptor signaling pathways regulating expression of GLRX5 Gene:


SOURCE GeneReport for Unigene cluster for GLRX5 Gene:


Evidence on tissue expression from TISSUES for GLRX5 Gene

  • Skin(4.2)
  • Heart(2.6)
  • Bone marrow(2.4)
  • Muscle(2.1)
  • Kidney(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for GLRX5 Gene

Germ Layers:
  • endoderm
  • mesoderm
  • cardiovascular
  • digestive
  • immune
  • liver
  • blood
  • red blood cell
  • white blood cell
genes like me logo Genes that share expression patterns with GLRX5: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for GLRX5 Gene

Orthologs for GLRX5 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for GLRX5 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia GLRX5 34 33
  • 99.79 (n)
(Rattus norvegicus)
Mammalia Glrx5 33
  • 88.82 (n)
(Mus musculus)
Mammalia Glrx5 16 34 33
  • 88.6 (n)
(Bos Taurus)
Mammalia GLRX5 34 33
  • 88.6 (n)
(Canis familiaris)
Mammalia GLRX5 34
  • 80 (a)
(Monodelphis domestica)
Mammalia GLRX5 34
  • 78 (a)
(Gallus gallus)
Aves GLRX5 34 33
  • 76.23 (n)
(Anolis carolinensis)
Reptilia GLRX5 34
  • 68 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia glrx5 33
  • 75.07 (n)
(Danio rerio)
Actinopterygii glrx5 34 33
  • 76.88 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG14407 34 33
  • 70.54 (n)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP002500 33
  • 69.42 (n)
(Caenorhabditis elegans)
Secernentea glrx-5 34 33
  • 54.9 (n)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0B09636g 33
  • 57.52 (n)
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_ADR053W 33
  • 56.23 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes GRX5 36 34 33
  • 54.37 (n)
bread mold
(Neurospora crassa)
Ascomycetes NCU04098 33
  • 60.2 (n)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.4846 34
  • 54 (a)
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes grx5 33
  • 50 (n)
Species where no ortholog for GLRX5 was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for GLRX5 Gene

Gene Tree for GLRX5 (if available)
Gene Tree for GLRX5 (if available)
Evolutionary constrained regions (ECRs) for GLRX5: view image

Paralogs for GLRX5 Gene

(1) SIMAP similar genes for GLRX5 Gene using alignment to 3 proteins:

  • Q9P1N5_HUMAN Pseudogenes for GLRX5 Gene

genes like me logo Genes that share paralogs with GLRX5: view

No data available for Paralogs for GLRX5 Gene

Variants for GLRX5 Gene

Sequence variations from dbSNP and Humsavar for GLRX5 Gene

SNP ID Clin Chr 14 pos Variation AA Info Type
rs121908584 pathogenic, Anemia, sideroblastic, pyridoxine-refractory, autosomal recessive 95,535,383(+) A/G coding_sequence_variant, synonymous_variant
rs765487627 pathogenic, Sideroblastic anemia 3, pyridoxine-refractory, Anemia, sideroblastic, 3, pyridoxine-refractory (SIDBA3) [MIM:616860] 95,544,094(+) T/C coding_sequence_variant, missense_variant
rs869312752 pathogenic, Sideroblastic anemia 3, pyridoxine-refractory, Anemia, sideroblastic, 3, pyridoxine-refractory (SIDBA3) [MIM:616860] 95,543,952(+) A/C coding_sequence_variant, missense_variant
rs869320757 pathogenic, Spasticity, childhood-onset, with hyperglycinemia 95,535,236(+) GAAGAAG/GAAG coding_sequence_variant, inframe_deletion
rs869320758 pathogenic, Spasticity, childhood-onset, with hyperglycinemia 95,535,169(+) CGGGCGTGCGGGCG/CGGGCGTGCGGGCGTGCGGGCG coding_sequence_variant, frameshift

Structural Variations from Database of Genomic Variants (DGV) for GLRX5 Gene

Variant ID Type Subtype PubMed ID
dgv89e55 CNV gain 17911159
esv2749054 CNV deletion 23290073
esv3635400 CNV gain 21293372
nsv1042858 CNV gain 25217958
nsv1046191 CNV gain 25217958
nsv565631 CNV gain 21841781

Variation tolerance for GLRX5 Gene

Gene Damage Index Score: 5.36; 70.89% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for GLRX5 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for GLRX5 Gene

Disorders for GLRX5 Gene

MalaCards: The human disease database

(7) MalaCards diseases for GLRX5 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search GLRX5 in MalaCards View complete list of genes associated with diseases


  • Anemia, sideroblastic, 3, pyridoxine-refractory (SIDBA3) [MIM:616860]: A form of sideroblastic anemia, a bone marrow disorder defined by the presence of pathologic iron deposits in erythroblast mitochondria. Sideroblastic anemia is characterized by anemia of varying severity, hypochromic peripheral erythrocytes, systemic iron overload secondary to chronic ineffective erythropoiesis, and the presence of bone marrow ringed sideroblasts. Sideroblasts are characterized by iron-loaded mitochondria clustered around the nucleus. SIDBA3 is refractory to treatment with vitamin B6, while iron chelation therapy may result in clinical improvement. SIDBA3 inheritance is autosomal recessive. {ECO:0000269 PubMed:17485548, ECO:0000269 PubMed:20364084, ECO:0000269 PubMed:25342667, ECO:0000269 PubMed:26100117}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Spasticity, childhood-onset, with hyperglycinemia (SPAHGC) [MIM:616859]: An autosomal recessive disorder characterized by childhood-onset of spasticity, spinal lesions, leukodystrophy, optic atrophy in some patients, non-ketotic hyperglycinemia, and defective enzymatic glycine cleavage. Glycine levels in the cerebrospinal fluid are mildly increased in some but not all patients. The increase is less pronounced than in patients with classic non-ketotic hyperglycinemia. {ECO:0000269 PubMed:24334290}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for GLRX5

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with GLRX5: view

No data available for Genatlas for GLRX5 Gene

Publications for GLRX5 Gene

  1. Glutaredoxin 5 deficiency causes sideroblastic anemia by specifically impairing heme biosynthesis and depleting cytosolic iron in human erythroblasts. (PMID: 20364084) Ye H … Rouault TA (The Journal of clinical investigation 2010) 3 4 22 58
  2. The human counterpart of zebrafish shiraz shows sideroblastic-like microcytic anemia and iron overload. (PMID: 17485548) Camaschella C … Iolascon A (Blood 2007) 3 4 22 58
  3. Mitochondrial Bol1 and Bol3 function as assembly factors for specific iron-sulfur proteins. (PMID: 27532772) Uzarska MA … Lill R (eLife 2016) 3 4 58
  4. Role of Nfu1 and Bol3 in iron-sulfur cluster transfer to mitochondrial clients. (PMID: 27532773) Melber A … Winge DR (eLife 2016) 3 4 58
  5. Variant non ketotic hyperglycinemia is caused by mutations in LIAS, BOLA3 and the novel gene GLRX5. (PMID: 24334290) Baker PR … Van Hove JL (Brain : a journal of neurology 2014) 3 4 58

Products for GLRX5 Gene

Sources for GLRX5 Gene

Loading form....