Free for academic non-profit institutions. Other users need a Commercial license

Aliases for LTBP3 Gene

Aliases for LTBP3 Gene

  • Latent Transforming Growth Factor Beta Binding Protein 3 2 3 5
  • LTBP-3 3 4
  • Latent-Transforming Growth Factor Beta-Binding Protein 3 3
  • Latent TGF Beta Binding Protein 3 3
  • GPHYSD3 3
  • STHAG6 3
  • Pp6425 3
  • LTBP2 3
  • DASS 3

External Ids for LTBP3 Gene

Previous HGNC Symbols for LTBP3 Gene

  • LTBP2

Previous GeneCards Identifiers for LTBP3 Gene

  • GC11M067821
  • GC11M066987
  • GC11M065556
  • GC11M065081
  • GC11M065063
  • GC11M065306
  • GC11M061633

Summaries for LTBP3 Gene

Entrez Gene Summary for LTBP3 Gene

  • The protein encoded by this gene forms a complex with transforming growth factor beta (TGF-beta) proteins and may be involved in their subcellular localization. Activation of this complex requires removal of the encoded binding protein. This protein also may play a structural role in the extracellular matrix. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]

GeneCards Summary for LTBP3 Gene

LTBP3 (Latent Transforming Growth Factor Beta Binding Protein 3) is a Protein Coding gene. Diseases associated with LTBP3 include Dental Anomalies And Short Stature and Geleophysic Dysplasia 3. Among its related pathways are ERK Signaling and Akt Signaling. Gene Ontology (GO) annotations related to this gene include calcium ion binding and transforming growth factor beta binding. An important paralog of this gene is LTBP1.

UniProtKB/Swiss-Prot for LTBP3 Gene

  • May be involved in the assembly, secretion and targeting of TGFB1 to sites at which it is stored and/or activated. May play critical roles in controlling and directing the activity of TGFB1. May have a structural role in the extracellular matrix (ECM).

Gene Wiki entry for LTBP3 Gene

Additional gene information for LTBP3 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for LTBP3 Gene

Genomics for LTBP3 Gene

GeneHancer (GH) Regulatory Elements for LTBP3 Gene

Promoters and enhancers for LTBP3 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH11J065550 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 650.7 +2.7 2738 11.3 HDGF PKNOX1 SMAD1 FOXA2 ZFP64 ARID4B SIN3A YBX1 FEZF1 ZNF2 LTBP3 ZFPL1 EIF1AD SF1 PCNX3 POLA2 SF3B2 SART1 MUS81 KAT5
GH11J065095 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 18.4 +462.2 462237 2.2 ZFP64 FEZF1 DMAP1 IRF4 YY1 ZNF213 E2F8 ZNF143 SP3 NFYC VPS51 ZFPL1 SF1 EIF1AD PCNX3 POLA2 SART1 FAU SF3B2 TRMT112
GH11J065414 Promoter/Enhancer 2.4 FANTOM5 Ensembl ENCODE dbSUPER 10.1 +134.7 134749 18.8 CLOCK MLX ZFP64 FEZF1 DMAP1 YBX1 IRF4 YY1 SLC30A9 ZNF213 NEAT1 ENSG00000278144 GC11P065538 ENSG00000278050 ENSG00000277599 SF1 LOC105369352 ZFPL1 POLA2 EIF1AD
GH11J066000 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 9.9 -443.4 -443353 3 CLOCK ZFP64 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ZNF143 SP3 EIF1AD BANF1 ENSG00000258297 ZFPL1 PCNX3 POLA2 RBM14 SART1 RBM4 SF3B2
GH11J065115 Promoter/Enhancer 1.8 Ensembl ENCODE dbSUPER 10.2 +441.6 441566 3.5 HDGF FOXA2 PKNOX1 CLOCK SMAD1 ARID4B SIN3A DMAP1 ZNF2 IRF4 ZNHIT2 ENSG00000278952 ENSG00000255173 KAT5 LOC105369342 SF3B2 ZFPL1 DPF2 SAC3D1 RPS16P6
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around LTBP3 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the LTBP3 gene promoter:
  • Nkx2-5
  • GATA-2
  • Spz1
  • E2F-1
  • E2F
  • C/EBPalpha
  • NRSF form 1
  • NRSF form 2
  • FOXO3
  • FOXO3a

Genomic Locations for LTBP3 Gene

Genomic Locations for LTBP3 Gene
chr11:65,538,559-65,558,930
(GRCh38/hg38)
Size:
20,372 bases
Orientation:
Minus strand
chr11:65,306,030-65,326,401
(GRCh37/hg19)
Size:
20,372 bases
Orientation:
Minus strand

Genomic View for LTBP3 Gene

Genes around LTBP3 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
LTBP3 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for LTBP3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for LTBP3 Gene

Proteins for LTBP3 Gene

  • Protein details for LTBP3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9NS15-LTBP3_HUMAN
    Recommended name:
    Latent-transforming growth factor beta-binding protein 3
    Protein Accession:
    Q9NS15
    Secondary Accessions:
    • O15107
    • Q96HB9
    • Q9H7K2
    • Q9UFN4

    Protein attributes for LTBP3 Gene

    Size:
    1303 amino acids
    Molecular mass:
    139359 Da
    Quaternary structure:
    • Forms part of the large latent transforming growth factor beta precursor complex; removal is essential for activation of complex.
    SequenceCaution:
    • Sequence=BAB15767.1; Type=Erroneous initiation; Evidence={ECO:0000305};

    Alternative splice isoforms for LTBP3 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for LTBP3 Gene

Post-translational modifications for LTBP3 Gene

  • Contains hydroxylated asparagine residues.
  • Two intrachain disulfide bonds from the TB3 domain are rearranged upon TGFB1 binding, and form interchain bonds with TGFB1 propeptide, anchoring it to the extracellular matrix.
  • Glycosylation at isoforms=21275, isoforms=2978, posLast=936936, posLast=845845, posLast=570570, isoforms=2561, posLast=519519, isoforms=2514, posLast=513513, posLast=349349, posLast=239239, and posLast=8989
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for LTBP3 Gene

Domains & Families for LTBP3 Gene

Gene Families for LTBP3 Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins
  • Predicted secreted proteins

Graphical View of Domain Structure for InterPro Entry

Q9NS15

UniProtKB/Swiss-Prot:

LTBP3_HUMAN :
  • Belongs to the LTBP family.
Family:
  • Belongs to the LTBP family.
genes like me logo Genes that share domains with LTBP3: view

Function for LTBP3 Gene

Molecular function for LTBP3 Gene

UniProtKB/Swiss-Prot Function:
May be involved in the assembly, secretion and targeting of TGFB1 to sites at which it is stored and/or activated. May play critical roles in controlling and directing the activity of TGFB1. May have a structural role in the extracellular matrix (ECM).
GENATLAS Biochemistry:
latent transforming growth factor beta,binding protein 3,involved in the formation of extracellular matrix,with homology to LTBP1 and fibrillin,including two isoforms,one of them binding to the 100kDa latent TGFB1 complex

Phenotypes From GWAS Catalog for LTBP3 Gene

Gene Ontology (GO) - Molecular Function for LTBP3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005509 calcium ion binding IEA --
GO:0019838 growth factor binding IEA --
GO:0050431 transforming growth factor beta binding IPI 10930463
genes like me logo Genes that share ontologies with LTBP3: view
genes like me logo Genes that share phenotypes with LTBP3: view

Human Phenotype Ontology for LTBP3 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for LTBP3 Gene

MGI Knock Outs for LTBP3:

Animal Model Products

miRNA for LTBP3 Gene

miRTarBase miRNAs that target LTBP3

Clone Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for LTBP3 Gene

Localization for LTBP3 Gene

Subcellular locations from UniProtKB/Swiss-Prot for LTBP3 Gene

Secreted. Note=Secretion occurs after coexpression with TGFB1 and requires complexing with Cys-33 of the TGFB1 propeptide. {ECO:0000250}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for LTBP3 gene
Compartment Confidence
extracellular 5
plasma membrane 3
endoplasmic reticulum 1
cytosol 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for LTBP3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region IDA,TAS --
GO:0031012 extracellular matrix IDA 16157329
GO:0070062 extracellular exosome HDA 19199708
genes like me logo Genes that share ontologies with LTBP3: view

Pathways & Interactions for LTBP3 Gene

genes like me logo Genes that share pathways with LTBP3: view

Gene Ontology (GO) - Biological Process for LTBP3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0036363 transforming growth factor beta activation IMP 18672106
GO:1902462 positive regulation of mesenchymal stem cell proliferation IMP 18672106
GO:2000741 positive regulation of mesenchymal stem cell differentiation IMP 18672106
genes like me logo Genes that share ontologies with LTBP3: view

No data available for SIGNOR curated interactions for LTBP3 Gene

Drugs & Compounds for LTBP3 Gene

No Compound Related Data Available

Transcripts for LTBP3 Gene

Unigene Clusters for LTBP3 Gene

Latent transforming growth factor beta binding protein 3:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for LTBP3 Gene

ExUns: 1 ^ 2a · 2b · 2c ^ 3 ^ 4 ^ 5a · 5b · 5c ^ 6 ^ 7 ^ 8 ^ 9a · 9b ^ 10 ^ 11a · 11b ^ 12 ^ 13 ^ 14 ^ 15a · 15b ^ 16 ^ 17a · 17b ^ 18 ^
SP1: -
SP2:
SP3:
SP4:
SP5:
SP6:
SP7:
SP8: -
SP9:
SP10:
SP11:
SP12:
SP13: - -
SP14: - -
SP15:
SP16:
SP17:
SP18: - -
SP19:
SP20:
SP21:

ExUns: 19a · 19b · 19c ^ 20 ^ 21a · 21b ^ 22a · 22b ^ 23a · 23b · 23c ^ 24a · 24b ^ 25a · 25b ^ 26a · 26b ^ 27a · 27b ^ 28 ^ 29 ^ 30 ^ 31 ^ 32a · 32b ^ 33a ·
SP1: - - - - - - -
SP2: - - - - -
SP3: - - -
SP4: - -
SP5:
SP6: - -
SP7:
SP8:
SP9: - - - -
SP10: - - -
SP11: -
SP12:
SP13:
SP14:
SP15: - - - - - - - - - -
SP16:
SP17:
SP18:
SP19:
SP20:
SP21:

Relevant External Links for LTBP3 Gene

GeneLoc Exon Structure for
LTBP3
ECgene alternative splicing isoforms for
LTBP3

Expression for LTBP3 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for LTBP3 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for LTBP3 Gene

This gene is overexpressed in Artery - Aorta (x4.4).

Protein differential expression in normal tissues from HIPED for LTBP3 Gene

This gene is overexpressed in Cerebrospinal fluid (15.8), Peripheral blood mononuclear cells (11.2), Gallbladder (8.3), Pancreas (7.2), Adrenal (7.2), and Heart (6.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for LTBP3 Gene



NURSA nuclear receptor signaling pathways regulating expression of LTBP3 Gene:

LTBP3

SOURCE GeneReport for Unigene cluster for LTBP3 Gene:

Hs.289019

mRNA Expression by UniProt/SwissProt for LTBP3 Gene:

Q9NS15-LTBP3_HUMAN
Tissue specificity: Isoform 2 is expressed prominently in heart, skeletal muscle, prostate, testis, small intestine and ovary. Isoform 1 is strongly expressed in pancreas and liver.

Evidence on tissue expression from TISSUES for LTBP3 Gene

  • Intestine(4.6)
  • Liver(4.4)
  • Nervous system(4.4)
  • Spleen(4.3)
  • Eye(3.6)
  • Muscle(2.6)
  • Heart(2.4)
  • Kidney(2)
  • Lung(2)
  • Skin(2)
  • Stomach(2)
  • Thyroid gland(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for LTBP3 Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • skeleton
Regions:
Head and neck:
  • chin
  • face
  • head
  • jaw
  • mandible
  • maxilla
  • mouth
  • neck
  • skull
  • tooth
Thorax:
  • chest wall
  • clavicle
  • rib
  • rib cage
  • scapula
  • sternum
Pelvis:
  • pelvis
Limb:
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
General:
  • spinal column
  • vertebrae
genes like me logo Genes that share expression patterns with LTBP3: view

No data available for Protein tissue co-expression partners for LTBP3 Gene

Orthologs for LTBP3 Gene

This gene was present in the common ancestor of animals.

Orthologs for LTBP3 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia LTBP3 34 33
  • 98.93 (n)
OneToOne
cow
(Bos Taurus)
Mammalia LTBP3 34 33
  • 90.59 (n)
OneToOne
rat
(Rattus norvegicus)
Mammalia Ltbp3 33
  • 87.1 (n)
mouse
(Mus musculus)
Mammalia Ltbp3 16 34 33
  • 87.04 (n)
oppossum
(Monodelphis domestica)
Mammalia LTBP3 34
  • 86 (a)
OneToOne
dog
(Canis familiaris)
Mammalia LTBP3 34 33
  • 84.67 (n)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia LTBP3 34
  • 81 (a)
OneToOne
chicken
(Gallus gallus)
Aves LTBP3 34
  • 31 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia LTBP3 34
  • 53 (a)
OneToOne
zebrafish
(Danio rerio)
Actinopterygii ltbp3 34 33
  • 57.35 (n)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta frac 34
  • 16 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 28 (a)
ManyToMany
-- 34
  • 27 (a)
ManyToMany
-- 34
  • 24 (a)
ManyToMany
-- 34
  • 23 (a)
ManyToMany
-- 34
  • 17 (a)
ManyToMany
Species where no ortholog for LTBP3 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for LTBP3 Gene

ENSEMBL:
Gene Tree for LTBP3 (if available)
TreeFam:
Gene Tree for LTBP3 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for LTBP3: view image

Paralogs for LTBP3 Gene

Paralogs for LTBP3 Gene

(12) SIMAP similar genes for LTBP3 Gene using alignment to 14 proteins:

  • LTBP3_HUMAN
  • B9EG76_HUMAN
  • E9PJR2_HUMAN
  • E9PKW1_HUMAN
  • E9PPT7_HUMAN
  • E9PQR0_HUMAN
  • E9PR75_HUMAN
  • E9PR84_HUMAN
  • E9PRF2_HUMAN
  • F5GWC4_HUMAN
  • H0YC99_HUMAN
  • H0YCQ2_HUMAN
  • H0YCX6_HUMAN
  • H0YE75_HUMAN
genes like me logo Genes that share paralogs with LTBP3: view

Variants for LTBP3 Gene

Sequence variations from dbSNP and Humsavar for LTBP3 Gene

SNP ID Clin Chr 11 pos Variation AA Info Type
rs121909145 pathogenic, Verloes Bourguignon syndrome 65,546,473(-) G/A/C coding_sequence_variant, non_coding_transcript_variant, stop_gained, synonymous_variant
rs145001056 likely-pathogenic, uncertain-significance, not provided, not specified 65,551,473(-) G/A coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs201590889 benign, Verloes Bourguignon syndrome 65,553,761(-) G/A coding_sequence_variant, non_coding_transcript_variant, synonymous_variant
rs373381192 uncertain-significance, Verloes Bourguignon syndrome 65,554,255(-) C/G/T coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs71036212 uncertain-significance, benign, Verloes Bourguignon syndrome, not specified 65,557,855(-) CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC/CAGCAGCAGCAGCAGCAGCAGC/CAGCAGCAGCAGCAGCAGCAGCAGC/CAGCAGCAGCAGCAGCAGCAGCAGCAGC/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 5_prime_UTR_variant, coding_sequence_variant, inframe_deletion, inframe_insertion, non_coding_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for LTBP3 Gene

Variant ID Type Subtype PubMed ID
esv1637796 CNV insertion 17803354
esv2671903 CNV deletion 23128226
esv987755 CNV insertion 20482838
nsv555212 CNV loss 21841781
nsv951018 CNV deletion 24416366

Variation tolerance for LTBP3 Gene

Residual Variation Intolerance Score: 9.91% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.88; 74.17% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for LTBP3 Gene

Human Gene Mutation Database (HGMD)
LTBP3
SNPedia medical, phenotypic, and genealogical associations of SNPs for
LTBP3

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for LTBP3 Gene

Disorders for LTBP3 Gene

MalaCards: The human disease database

(18) MalaCards diseases for LTBP3 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
dental anomalies and short stature
  • dass
geleophysic dysplasia 3
  • gphysd3
geleophysic dysplasia
  • geleophysic dwarfism
brachyolmia
  • brachyrachia
acromicric dysplasia
  • acmicd
- elite association - COSMIC cancer census association via MalaCards
Search LTBP3 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

LTBP3_HUMAN
  • Dental anomalies and short stature (DASS) [MIM:601216]: A disorder characterized by hypoplastic amelogenesis imperfecta, significant short stature, brachyolmia-like anomalies including platyspondyly with short pedicles, narrow intervertebral and interpedicular distances, rectangular-shaped vertebrae with posterior scalloping and herniation of the nuclei, and broad femoral necks. Dental anomalies include widely spaced, small, yellow teeth, oligodontia, and severely reduced to absent enamel. {ECO:0000269 PubMed:19344874}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for LTBP3

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with LTBP3: view

No data available for Genatlas for LTBP3 Gene

Publications for LTBP3 Gene

  1. Oligodontia is caused by mutation in LTBP3, the gene encoding latent TGF-beta binding protein 3. (PMID: 19344874) Noor A … Vincent JB (American journal of human genetics 2009) 3 4 22 58
  2. Secretion of human latent TGF-beta-binding protein-3 (LTBP-3) is dependent on co-expression of TGF-beta. (PMID: 12154076) Penttinen C … Keski-Oja J (Journal of cell science 2002) 3 4 22 58
  3. Analysis of the expression pattern of the latent transforming growth factor beta binding protein isoforms in normal and diseased human liver reveals a new splice variant missing the proteinase-sensitive hinge region. (PMID: 9620332) Michel K … Gressner AM (Hepatology (Baltimore, Md.) 1998) 3 4 22 58
  4. Assessment of the association between genetic polymorphisms in transforming growth factor beta, and its binding protein (LTBP), and the presence, and expansion, of Abdominal Aortic Aneurysm. (PMID: 19897194) Thompson AR … Humphries SE (Atherosclerosis 2010) 3 44 58
  5. Interferon gamma receptor 2 gene variants are associated with liver fibrosis in patients with chronic hepatitis C infection. (PMID: 20587546) Nalpas B … Abel L (Gut 2010) 3 44 58

Products for LTBP3 Gene