Free for academic non-profit institutions. Other users need a Commercial license

Aliases for HOXA13 Gene

Aliases for HOXA13 Gene

  • Homeobox A13 2 3 5
  • Homeobox Protein Hox-1J 3 4
  • Homeo Box A13 2 3
  • HOX1J 3 4
  • Transcription Factor HOXA13 3
  • Homeobox Protein Hox-A13 3
  • Homeobox Protein HOXA13 3
  • Homeo Box 1J 3
  • HOX1 3

External Ids for HOXA13 Gene

Previous HGNC Symbols for HOXA13 Gene

  • HOX1J
  • HOX1

Previous GeneCards Identifiers for HOXA13 Gene

  • GC07M026880
  • GC07M026944
  • GC07M026978
  • GC07M027009
  • GC07M027203
  • GC07M027235
  • GC07M027246
  • GC07M027256
  • GC07M027194

Summaries for HOXA13 Gene

Entrez Gene Summary for HOXA13 Gene

  • In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Expansion of a polyalanine tract in the encoded protein can cause hand-foot-uterus syndrome, also known as hand-foot-genital syndrome. [provided by RefSeq, Jul 2008]

GeneCards Summary for HOXA13 Gene

HOXA13 (Homeobox A13) is a Protein Coding gene. Diseases associated with HOXA13 include Hand-Foot-Genital Syndrome and Preaxial Deficiency, Postaxial Polydactyly, And Hypospadias. Gene Ontology (GO) annotations related to this gene include DNA binding transcription factor activity and transcription regulatory region DNA binding. An important paralog of this gene is HOXC13.

UniProtKB/Swiss-Prot for HOXA13 Gene

  • Sequence-specific, AT-rich binding transcription factor which is part of a developmental regulatory system that provides cells with specific positional identities on the anterior-posterior axis.

  • Sequence-specific transcription factor which is part of a developmental regulatory system that provides cells with specific positional identities on the anterior-posterior axis.

Gene Wiki entry for HOXA13 Gene

Additional gene information for HOXA13 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for HOXA13 Gene

Genomics for HOXA13 Gene

GeneHancer (GH) Regulatory Elements for HOXA13 Gene

Promoters and enhancers for HOXA13 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH07I027199 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE dbSUPER 550.8 -0.1 -96 1.5 INSM2 KLF17 SIN3A ZNF76 GLI4 ZNF2 ZEB1 ZNF335 GLIS2 ZNF213 ENSG00000277469 ENSG00000278708 HOTTIP HOXA13 ENSG00000276609 HOXA10-AS
GH07I027202 Enhancer 0.7 ENCODE dbSUPER 550.8 -1.3 -1251 0.2 ZNF449 SUZ12 ZNF600 MYC PRDM1 SPI1 EZH2 ENSG00000276609 ENSG00000277469 ENSG00000278708 HOXA13 HOTTIP
GH07I027201 Enhancer 0.6 ENCODE dbSUPER 550.8 -1.0 -991 0.2 SUZ12 PRDM1 EZH2 ENSG00000277469 ENSG00000278708 HOXA13 ENSG00000276609 HOTTIP
GH07I027095 Promoter/Enhancer 3.4 VISTA UCNEbase EPDnew FANTOM5 Ensembl ENCODE dbSUPER 12.8 +62.1 62071 86.3 MLX FEZF1 DMAP1 YY1 ZNF213 ZNF143 SP3 NFYC SSRP1 ZNF610 HOXA2 HOXA9 HOXA10 HOXA1 HOXA3 HOXA6 HOXA4 HOXA5 HOXA7 HNRNPA2B1
GH07I027920 Enhancer 1 Ensembl ENCODE 11.6 -721.0 -721049 0.6 MZF1 ZNF76 SIN3A BMI1 FEZF1 ZNF2 RAD21 RFX5 ZNF335 ZNF213 ENSG00000253508 HOTTIP HOXA13 HOXA11 HOXA11-AS HOXA9 HOXA10 ENSG00000253308 EVX1 EVX1-AS
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around HOXA13 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the HOXA13 gene promoter:

Genomic Locations for HOXA13 Gene

Genomic Locations for HOXA13 Gene
chr7:27,193,419-27,200,266
(GRCh38/hg38)
Size:
6,848 bases
Orientation:
Minus strand
chr7:27,233,122-27,239,725
(GRCh37/hg19)

Genomic View for HOXA13 Gene

Genes around HOXA13 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
HOXA13 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for HOXA13 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for HOXA13 Gene

Proteins for HOXA13 Gene

  • Protein details for HOXA13 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P31271-HXA13_HUMAN
    Recommended name:
    Homeobox protein Hox-A13
    Protein Accession:
    P31271
    Secondary Accessions:
    • A4D188
    • O43371

    Protein attributes for HOXA13 Gene

    Size:
    388 amino acids
    Molecular mass:
    39727 Da
    Quaternary structure:
    • Binds DNA as a homodimer. Interacts with MEIS1, MEIS2 and MEIS3 (By similarity).

    Three dimensional structures from OCA and Proteopedia for HOXA13 Gene

neXtProt entry for HOXA13 Gene

Post-translational modifications for HOXA13 Gene

  • Ubiquitination at isoforms=303
  • Modification sites at PhosphoSitePlus

Other Protein References for HOXA13 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for HOXA13 Gene

Domains & Families for HOXA13 Gene

Gene Families for HOXA13 Gene

HGNC:
Human Protein Atlas (HPA):
  • Cancer-related genes
  • Disease related genes
  • Predicted intracellular proteins
  • Transcription factors

Protein Domains for HOXA13 Gene

Suggested Antigen Peptide Sequences for HOXA13 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

P31271

UniProtKB/Swiss-Prot:

HXA13_HUMAN :
  • Belongs to the Abd-B homeobox family.
Family:
  • Belongs to the Abd-B homeobox family.
genes like me logo Genes that share domains with HOXA13: view

Function for HOXA13 Gene

Molecular function for HOXA13 Gene

GENATLAS Biochemistry:
homeo box A13(1J),homologous to mouse Hox-1.10 (hypodactyly),expressed in the developing lower genitourinary tract (abnormal seminal vesicle and prostate development),altered in hypodactyly mutants
UniProtKB/Swiss-Prot Function:
Sequence-specific, AT-rich binding transcription factor which is part of a developmental regulatory system that provides cells with specific positional identities on the anterior-posterior axis.
UniProtKB/Swiss-Prot Function:
Sequence-specific transcription factor which is part of a developmental regulatory system that provides cells with specific positional identities on the anterior-posterior axis.

Phenotypes From GWAS Catalog for HOXA13 Gene

Gene Ontology (GO) - Molecular Function for HOXA13 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003677 DNA binding TAS 9020844
GO:0043565 sequence-specific DNA binding IMP 23332764
genes like me logo Genes that share ontologies with HOXA13: view
genes like me logo Genes that share phenotypes with HOXA13: view

Human Phenotype Ontology for HOXA13 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for HOXA13 Gene

MGI Knock Outs for HOXA13:

Animal Model Products

CRISPR Products

miRNA for HOXA13 Gene

miRTarBase miRNAs that target HOXA13

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for HOXA13 Gene

Localization for HOXA13 Gene

Subcellular locations from UniProtKB/Swiss-Prot for HOXA13 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for HOXA13 gene
Compartment Confidence
cytoskeleton 5
nucleus 5
extracellular 1

Gene Ontology (GO) - Cellular Components for HOXA13 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA --
GO:0005654 nucleoplasm IDA --
GO:0045111 intermediate filament cytoskeleton IDA --
genes like me logo Genes that share ontologies with HOXA13: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for HOXA13 Gene

Pathways & Interactions for HOXA13 Gene

SuperPathways for HOXA13 Gene

No Data Available

SIGNOR curated interactions for HOXA13 Gene

Activates:

Gene Ontology (GO) - Biological Process for HOXA13 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001501 skeletal system development TAS 9020844
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0007275 multicellular organism development IEA --
genes like me logo Genes that share ontologies with HOXA13: view

No data available for Pathways by source for HOXA13 Gene

Drugs & Compounds for HOXA13 Gene

(1) Drugs for HOXA13 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
genes like me logo Genes that share compounds with HOXA13: view

Transcripts for HOXA13 Gene

mRNA/cDNA for HOXA13 Gene

(1) REFSEQ mRNAs :
(2) Additional mRNA sequences :
(47) Selected AceView cDNA sequences:
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for HOXA13 Gene

Homeobox A13:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for HOXA13 Gene

No ASD Table

Relevant External Links for HOXA13 Gene

GeneLoc Exon Structure for
HOXA13
ECgene alternative splicing isoforms for
HOXA13

Expression for HOXA13 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for HOXA13 Gene

mRNA differential expression in normal tissues according to GTEx for HOXA13 Gene

This gene is overexpressed in Cervix - Ectocervix (x11.5), Cervix - Endocervix (x11.2), Vagina (x7.6), Bladder (x7.0), Prostate (x4.9), and Colon - Transverse (x4.5).

Protein differential expression in normal tissues from HIPED for HOXA13 Gene

This gene is overexpressed in Cervix (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for HOXA13 Gene



Protein tissue co-expression partners for HOXA13 Gene

NURSA nuclear receptor signaling pathways regulating expression of HOXA13 Gene:

HOXA13

SOURCE GeneReport for Unigene cluster for HOXA13 Gene:

Hs.592172

Phenotype-based relationships between genes and organs from Gene ORGANizer for HOXA13 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • immune
  • integumentary
  • reproductive
  • skeletal muscle
  • skeleton
  • urinary
Regions:
Abdomen:
  • kidney
Pelvis:
  • ovary
  • penis
  • ureter
  • urethra
  • urinary bladder
  • uterus
  • vagina
Limb:
  • digit
  • finger
  • foot
  • hand
  • lower limb
  • nail
  • toe
  • upper limb
General:
  • blood
  • skin
  • white blood cell
genes like me logo Genes that share expression patterns with HOXA13: view

No data available for mRNA Expression by UniProt/SwissProt and Evidence on tissue expression from TISSUES for HOXA13 Gene

Orthologs for HOXA13 Gene

This gene was present in the common ancestor of animals.

Orthologs for HOXA13 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia HOXA13 33 34
  • 99.31 (n)
dog
(Canis familiaris)
Mammalia HOXA13 33 34
  • 93.73 (n)
oppossum
(Monodelphis domestica)
Mammalia HOXA13 34
  • 92 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Hoxa13 33 16 34
  • 91.02 (n)
rat
(Rattus norvegicus)
Mammalia Hoxa13 33
  • 90.33 (n)
cow
(Bos Taurus)
Mammalia HOXA13 33 34
  • 89.25 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia HOXA13 34
  • 77 (a)
OneToOne
chicken
(Gallus gallus)
Aves HOXA13 34 34 34
  • 84 (a)
OneToMany
LOC100859244 33
  • 81.31 (n)
lizard
(Anolis carolinensis)
Reptilia HOXA13 34
  • 46 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia hoxa13 33
  • 72.66 (n)
African clawed frog
(Xenopus laevis)
Amphibia hoxa13-A 33
zebrafish
(Danio rerio)
Actinopterygii hoxa13b 33 34
  • 65.61 (n)
hoxa13a 34
  • 65 (a)
OneToMany
fruit fly
(Drosophila melanogaster)
Insecta Abd-B 34
  • 16 (a)
OneToMany
Species where no ortholog for HOXA13 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for HOXA13 Gene

ENSEMBL:
Gene Tree for HOXA13 (if available)
TreeFam:
Gene Tree for HOXA13 (if available)

Paralogs for HOXA13 Gene

(5) SIMAP similar genes for HOXA13 Gene using alignment to 3 proteins:

genes like me logo Genes that share paralogs with HOXA13: view

Variants for HOXA13 Gene

Sequence variations from dbSNP and Humsavar for HOXA13 Gene

SNP ID Clin Chr 07 pos Variation AA Info Type
rs104894019 pathogenic, Hand foot uterus syndrome 27,198,258(-) C/T coding_sequence_variant, stop_gained
rs121912542 pathogenic, Hand foot uterus syndrome, Hand-foot-genital syndrome (HFG) [MIM:140000] 27,198,251(-) T/G coding_sequence_variant, missense_variant
rs387906542 pathogenic, Hand foot uterus syndrome 27,199,672(-) AGGACGACGCGGCGGCGGCGGCGGCGGCTGCAGCGGCAGCCGCGGCAGCAGC/AGGACGACGCGGCGGCGGCGGCGGCGGCTGCAGCGGCAGCCGCGGCAGCAGCAGGACGACGCGGCGGCGGCGGCGGCGGCTGCAGCGGCAGCCGCGGCAGCAGC coding_sequence_variant, frameshift
VAR_017775 Guttmacher syndrome (GUTTS) [MIM:176305] p.Gln371Leu
VAR_075341 Hand-foot-genital syndrome (HFG) [MIM:140000] p.Ile368Phe

Structural Variations from Database of Genomic Variants (DGV) for HOXA13 Gene

Variant ID Type Subtype PubMed ID
dgv1094n67 CNV gain 20364138
nsv1075019 CNV deletion 25765185
nsv5675 CNV insertion 18451855
nsv606468 CNV loss 21841781
nsv606469 CNV loss 21841781
nsv7393 OTHER inversion 18451855
nsv824042 CNV gain 20364138

Variation tolerance for HOXA13 Gene

Residual Variation Intolerance Score: 51.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.41; 42.64% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for HOXA13 Gene

Human Gene Mutation Database (HGMD)
HOXA13
SNPedia medical, phenotypic, and genealogical associations of SNPs for
HOXA13

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for HOXA13 Gene

Disorders for HOXA13 Gene

MalaCards: The human disease database

(8) MalaCards diseases for HOXA13 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

- elite association - COSMIC cancer census association via MalaCards

UniProtKB/Swiss-Prot

HXA13_HUMAN
  • Guttmacher syndrome (GUTTS) [MIM:176305]: Dominantly inherited combination of distal limb and genital tract abnormalities. It has several features in common with hand-foot-genital syndrome, including hypoplastic first digits and hypospadias. Typical features not seen in hand-foot-genital syndrome include postaxial polydactyly of the hands and uniphalangeal second toes with absent nails. {ECO:0000269 PubMed:11968094}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Hand-foot-genital syndrome (HFG) [MIM:140000]: A disorder characterized by limb and genitourinary anomalies. Clinical features include small feet with unusually short great toes and abnormal thumbs. Females with the disorder have duplication of the genital tract. {ECO:0000269 PubMed:10839976, ECO:0000269 PubMed:12073020, ECO:0000269 PubMed:24934387, ECO:0000269 PubMed:26590955}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for HOXA13

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with HOXA13: view

No data available for Genatlas for HOXA13 Gene

Publications for HOXA13 Gene

  1. A HOXA13 allele with a missense mutation in the homeobox and a dinucleotide deletion in the promoter underlies Guttmacher syndrome. (PMID: 11968094) Innis JW … Guttmacher AE (Human mutation 2002) 3 4 22 58
  2. Novel HOXA13 mutations and the phenotypic spectrum of hand-foot-genital syndrome. (PMID: 10839976) Goodman FR … Scambler PJ (American journal of human genetics 2000) 3 4 22 58
  3. Mutation of HOXA13 in hand-foot-genital syndrome. (PMID: 9020844) Mortlock DP … Innis JW (Nature genetics 1997) 3 4 22 58
  4. Dual genetic diagnoses: Atypical hand-foot-genital syndrome and developmental delay due to de novo mutations in HOXA13 and NRXN1. (PMID: 26590955) Wallis M … Patel C (American journal of medical genetics. Part A 2016) 3 4 58
  5. Structural basis for sequence specific DNA binding and protein dimerization of HOXA13. (PMID: 21829694) Zhang Y … Ames JB (PloS one 2011) 3 4 58

Products for HOXA13 Gene

Sources for HOXA13 Gene

Content
Loading form....