Free for academic non-profit institutions. Other users need a Commercial license

Aliases for WWC1 Gene

Aliases for WWC1 Gene

  • WW And C2 Domain Containing 1 2 3 5
  • Protein Phosphatase 1, Regulatory Subunit 168 2 3
  • WW, C2 And Coiled-Coil Domain Containing 1 2 3
  • Kidney And Brain Protein 3 4
  • HBeAg-Binding Protein 3 3 4
  • KIBRA 3 4
  • WW Domain-Containing Protein 1 4
  • Protein KIBRA 3
  • Protein WWC1 3
  • MEMRYQTL 3
  • PPP1R168 3
  • KIAA0869 4
  • HBEBP36 3
  • HBEBP3 3

External Ids for WWC1 Gene

Previous GeneCards Identifiers for WWC1 Gene

  • GC05P167652
  • GC05P162818

Summaries for WWC1 Gene

Entrez Gene Summary for WWC1 Gene

  • The protein encoded by this gene is a cytoplasmic phosphoprotein that interacts with PRKC-zeta and dynein light chain-1. Alleles of this gene have been found that enhance memory in some individuals. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]

GeneCards Summary for WWC1 Gene

WWC1 (WW And C2 Domain Containing 1) is a Protein Coding gene. Diseases associated with WWC1 include Memory Quantitative Trait Locus. Among its related pathways are Wnt / Hedgehog / Notch and Hippo signaling pathway. Gene Ontology (GO) annotations related to this gene include transcription coactivator activity and protein binding, bridging. An important paralog of this gene is WWC2.

UniProtKB/Swiss-Prot for WWC1 Gene

  • Probable regulator of the Hippo/SWH (Sav/Wts/Hpo) signaling pathway, a signaling pathway that plays a pivotal role in tumor suppression by restricting proliferation and promoting apoptosis. Along with NF2 can synergistically induce the phosphorylation of LATS1 and LATS2 and can probably function in the regulation of the Hippo/SWH (Sav/Wts/Hpo) signaling pathway. Acts as a transcriptional coactivator of ESR1 which plays an essential role in DYNLL1-mediated ESR1 transactivation. Regulates collagen-stimulated activation of the ERK/MAPK cascade. Modulates directional migration of podocytes. Acts as a substrate for PRKCZ. Plays a role in cognition and memory performance.

Gene Wiki entry for WWC1 Gene

Additional gene information for WWC1 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for WWC1 Gene

Genomics for WWC1 Gene

GeneHancer (GH) Regulatory Elements for WWC1 Gene

Promoters and enhancers for WWC1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH05J168290 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE dbSUPER 661 +0.3 310 2.4 ARID4B SIN3A ZNF48 YY1 GLIS2 ELK1 ZNF143 SP3 SP5 REST WWC1 GC05P168295
GH05J168327 Enhancer 1.1 Ensembl ENCODE dbSUPER 23.4 +37.4 37381 2.2 FOXA2 FEZF1 ZNF2 FOXK2 SCRT2 PRDM10 ATF7 TCF7L2 SCRT1 TEAD1 WWC1 ENSG00000254192 GC05P168295 RARS
GH05J168360 Enhancer 1.1 ENCODE dbSUPER 22.9 +70.1 70079 3.1 PKNOX1 FOXA2 ARID4B SIN3A YY1 FOS RXRA SP5 MXD4 MIER2 WWC1 GC05P168295 RARS
GH05J168312 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 12.8 +24.1 24136 6.9 CLOCK FOXA2 ZFP64 ARID4B NEUROD1 SIN3A FEZF1 ZNF2 YY1 FOS WWC1 GC05P168295 RARS
GH05J168363 Enhancer 1.2 Ensembl ENCODE dbSUPER 17.2 +73.7 73702 3.2 SIN3A ZNF48 RAD21 ZNF614 RCOR1 CEBPB ELF1 GATAD2B MIER2 REST WWC1 FBLL1 GC05P168295 RARS
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around WWC1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the WWC1 gene promoter:
  • E2F
  • Sox5
  • E2F-5
  • E2F-1
  • E2F-2
  • E2F-3a

Genomic Locations for WWC1 Gene

Genomic Locations for WWC1 Gene
chr5:168,291,651-168,472,303
(GRCh38/hg38)
Size:
180,653 bases
Orientation:
Plus strand
chr5:167,718,656-167,899,308
(GRCh37/hg19)
Size:
180,653 bases
Orientation:
Plus strand

Genomic View for WWC1 Gene

Genes around WWC1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
WWC1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for WWC1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for WWC1 Gene

Proteins for WWC1 Gene

  • Protein details for WWC1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q8IX03-KIBRA_HUMAN
    Recommended name:
    Protein KIBRA
    Protein Accession:
    Q8IX03
    Secondary Accessions:
    • B4DK05
    • O94946
    • Q6MZX4
    • Q6Y2F8
    • Q7Z4G8
    • Q8WVM4
    • Q9BT29

    Protein attributes for WWC1 Gene

    Size:
    1113 amino acids
    Molecular mass:
    125301 Da
    Quaternary structure:
    • Homodimer. Interacts with DDN. Interacts with DYNLL1 and histone H3. The interaction with DYNLL1 is mandatory for the recruitment and transactivation functions of ESR1 or DYNLL1 to the target chromatin and the interaction with histone H3 ensures proper regulatory interaction of WWC1-DYNLL1-ESR1 complexes with target chromatin. Interacts (via WW domains) with DDR1 (via PPxY motif) in a collagen-regulated manner. Interacts with PRKCZ (via the protein kinase domain). Forms a tripartite complex with DDR1 and PRKCZ, but predominantly in the absence of collagen. Interacts (via the ADDV motif) with PATJ (via PDZ domain 8). Interacts (via WW domains) with SYNPO (via PPxY motifs). Interacts with NF2 and SNX4.

    Three dimensional structures from OCA and Proteopedia for WWC1 Gene

    Alternative splice isoforms for WWC1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for WWC1 Gene

Post-translational modifications for WWC1 Gene

  • Phosphorylation at Ser-542 and Ser-931 by CDK1 in response to spindle damage stress regulates mitotic exit, these two sites are dephosphorylated by CDC14B.
  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for WWC1 Gene

Domains & Families for WWC1 Gene

Gene Families for WWC1 Gene

Protein Domains for WWC1 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for WWC1 Gene

Graphical View of Domain Structure for InterPro Entry

Q8IX03

UniProtKB/Swiss-Prot:

KIBRA_HUMAN :
  • The C2-domain mediates homodimerization. It is a calcium-sensitive lipid-binding domain with preference for PI(3)P.
  • Belongs to the WWC family. KIBRA subfamily.
Domain:
  • The C2-domain mediates homodimerization. It is a calcium-sensitive lipid-binding domain with preference for PI(3)P.
Family:
  • Belongs to the WWC family. KIBRA subfamily.
genes like me logo Genes that share domains with WWC1: view

Function for WWC1 Gene

Molecular function for WWC1 Gene

UniProtKB/Swiss-Prot Function:
Probable regulator of the Hippo/SWH (Sav/Wts/Hpo) signaling pathway, a signaling pathway that plays a pivotal role in tumor suppression by restricting proliferation and promoting apoptosis. Along with NF2 can synergistically induce the phosphorylation of LATS1 and LATS2 and can probably function in the regulation of the Hippo/SWH (Sav/Wts/Hpo) signaling pathway. Acts as a transcriptional coactivator of ESR1 which plays an essential role in DYNLL1-mediated ESR1 transactivation. Regulates collagen-stimulated activation of the ERK/MAPK cascade. Modulates directional migration of podocytes. Acts as a substrate for PRKCZ. Plays a role in cognition and memory performance.
UniProtKB/Swiss-Prot Induction:
Strongly up-regulated by progestin treatment.

Phenotypes From GWAS Catalog for WWC1 Gene

Gene Ontology (GO) - Molecular Function for WWC1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003713 transcription coactivator activity IDA 16684779
GO:0005515 protein binding IPI,IEA 16684779
GO:0019900 kinase binding IPI 24682284
GO:0032947 protein-containing complex scaffold activity IDA 24682284
genes like me logo Genes that share ontologies with WWC1: view
genes like me logo Genes that share phenotypes with WWC1: view

Animal Models for WWC1 Gene

MGI Knock Outs for WWC1:
  • Wwc1 Wwc1<tm1.1Rlh>
  • Wwc1 Wwc1<tm1.1Arsc>

Animal Model Products

CRISPR Products

miRNA for WWC1 Gene

miRTarBase miRNAs that target WWC1

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for WWC1

Clone Products

  • Addgene plasmids for WWC1

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for WWC1 Gene

Localization for WWC1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for WWC1 Gene

Cytoplasm. Cytoplasm, perinuclear region. Nucleus. Cell projection, ruffle membrane. Note=Colocalizes with PRKCZ in the perinuclear region.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for WWC1 gene
Compartment Confidence
plasma membrane 5
nucleus 5
cytosol 5
golgi apparatus 3
cytoskeleton 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Golgi apparatus (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for WWC1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA,IDA 16684779
GO:0005737 cytoplasm IEA,IDA 16684779
GO:0005829 cytosol TAS,IDA --
GO:0005886 plasma membrane IEA --
GO:0016020 membrane IEA --
genes like me logo Genes that share ontologies with WWC1: view

Pathways & Interactions for WWC1 Gene

genes like me logo Genes that share pathways with WWC1: view

Pathways by source for WWC1 Gene

1 BioSystems pathway for WWC1 Gene
2 Reactome pathways for WWC1 Gene
1 Cell Signaling Technology pathway for WWC1 Gene

SIGNOR curated interactions for WWC1 Gene

Is activated by:
Other effect:

Gene Ontology (GO) - Biological Process for WWC1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription by RNA polymerase II IDA 24682284
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0007221 positive regulation of transcription of Notch receptor target TAS --
GO:0016477 cell migration IEA,IDA 18596123
genes like me logo Genes that share ontologies with WWC1: view

Drugs & Compounds for WWC1 Gene

No Compound Related Data Available

Transcripts for WWC1 Gene

Unigene Clusters for WWC1 Gene

WW and C2 domain containing 1:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for WWC1

Clone Products

  • Addgene plasmids for WWC1

Alternative Splicing Database (ASD) splice patterns (SP) for WWC1 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7a · 7b · 7c · 7d ^ 8a · 8b · 8c ^ 9a · 9b · 9c ^ 10 ^ 11 ^ 12a · 12b · 12c ^ 13 ^ 14a · 14b ^ 15 ^
SP1: - -
SP2:
SP3:
SP4: -
SP5:
SP6: - - - -
SP7:
SP8: - - - -
SP9: - - - -
SP10: - - - -
SP11:
SP12:
SP13:
SP14:
SP15:
SP16:
SP17:

ExUns: 16 ^ 17a · 17b · 17c ^ 18 ^ 19 ^ 20 ^ 21a · 21b ^ 22 ^ 23a · 23b ^ 24 ^ 25a · 25b ^ 26a · 26b ^ 27a · 27b
SP1:
SP2: -
SP3:
SP4:
SP5:
SP6:
SP7:
SP8:
SP9:
SP10:
SP11: -
SP12: -
SP13:
SP14:
SP15:
SP16:
SP17:

Relevant External Links for WWC1 Gene

GeneLoc Exon Structure for
WWC1
ECgene alternative splicing isoforms for
WWC1

Expression for WWC1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for WWC1 Gene

mRNA differential expression in normal tissues according to GTEx for WWC1 Gene

This gene is overexpressed in Kidney - Cortex (x4.7).

Protein differential expression in normal tissues from HIPED for WWC1 Gene

This gene is overexpressed in Plasma (58.6) and Heart (6.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for WWC1 Gene



Protein tissue co-expression partners for WWC1 Gene

NURSA nuclear receptor signaling pathways regulating expression of WWC1 Gene:

WWC1

SOURCE GeneReport for Unigene cluster for WWC1 Gene:

Hs.484047

mRNA Expression by UniProt/SwissProt for WWC1 Gene:

Q8IX03-KIBRA_HUMAN
Tissue specificity: Expressed in mammary epithelial cells and breast cancer cell lines. Found in the luminal epithelium surrounding the ducts in the normal breast. In the brain, expressed in somatodendritic compartment of neurons in the cortex and hippocampus and in the cerebellum it is found in the Purkinje cells and some granule cells (at protein level). Detected in brain, heart, colon and kidney. In the kidney, expressed in glomerular podocytes, in some tubules and in the collecting duct.

Evidence on tissue expression from TISSUES for WWC1 Gene

  • Nervous system(4.6)
  • Liver(4.2)
  • Kidney(2.4)
genes like me logo Genes that share expression patterns with WWC1: view

No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for WWC1 Gene

Orthologs for WWC1 Gene

This gene was present in the common ancestor of animals.

Orthologs for WWC1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia WWC1 34 33
  • 99.55 (n)
OneToOne
cow
(Bos Taurus)
Mammalia WWC1 34
  • 94 (a)
OneToOne
LOC520730 33
  • 90.08 (n)
dog
(Canis familiaris)
Mammalia WWC1 34 33
  • 91.19 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Wwc1 16 34 33
  • 87.58 (n)
rat
(Rattus norvegicus)
Mammalia Wwc1 33
  • 87.05 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 85 (a)
OneToMany
-- 34
  • 75 (a)
OneToMany
oppossum
(Monodelphis domestica)
Mammalia WWC1 34
  • 84 (a)
OneToOne
chicken
(Gallus gallus)
Aves WWC1 34 33
  • 72.53 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia WWC1 34
  • 72 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia wwc2 33
  • 66.49 (n)
Str.16961 33
zebrafish
(Danio rerio)
Actinopterygii si:dkey-174n5.3 33
  • 62.43 (n)
WWC1 34
  • 54 (a)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta kibra 34
  • 28 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea CSA.5313 34
  • 61 (a)
ManyToMany
CSA.8937 34
  • 22 (a)
ManyToMany
Species where no ortholog for WWC1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for WWC1 Gene

ENSEMBL:
Gene Tree for WWC1 (if available)
TreeFam:
Gene Tree for WWC1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for WWC1: view image

Paralogs for WWC1 Gene

Paralogs for WWC1 Gene

(2) SIMAP similar genes for WWC1 Gene using alignment to 5 proteins:

  • KIBRA_HUMAN
  • H0YAU4_HUMAN
  • H0YBE8_HUMAN
  • H3BLZ3_HUMAN
  • L8E9S6_HUMAN
genes like me logo Genes that share paralogs with WWC1: view

Variants for WWC1 Gene

Polymorphic Variants from UniProtKB/Swiss-Prot for WWC1 Gene

KIBRA_HUMAN-Q8IX03
Genetic variations in WWC1 define the memory quantitative trait locus (MEMRYQTL) [MIM:615602].

Sequence variations from dbSNP and Humsavar for WWC1 Gene

SNP ID Clin Chr 05 pos Variation AA Info Type
rs17070145 association, Memory quantitative trait locus 168,418,786(+) C/T intron_variant
rs386352379 uncertain-significance, not provided 168,428,128(+) G/A coding_sequence_variant, missense_variant
rs11279828 benign, not specified 168,431,458(+) CTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTG/CTGGCTGGCTGGCTGGCTGGCTG/CTGGCTGGCTGGCTGGCTGGCTGGCTGGCTG/CTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTG/CTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTG/CTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTG/CTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTG intron_variant
rs1000013520 -- 168,440,394(+) A/T intron_variant
rs1000014535 -- 168,458,096(+) T/C intron_variant

Structural Variations from Database of Genomic Variants (DGV) for WWC1 Gene

Variant ID Type Subtype PubMed ID
esv3388542 CNV insertion 20981092
nsv1074343 CNV deletion 25765185
nsv1114757 CNV deletion 24896259
nsv5118 CNV insertion 18451855
nsv5119 CNV deletion 18451855
nsv5120 CNV insertion 18451855
nsv823340 CNV loss 20364138

Variation tolerance for WWC1 Gene

Residual Variation Intolerance Score: 7.06% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 11.31; 92.61% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for WWC1 Gene

Human Gene Mutation Database (HGMD)
WWC1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
WWC1

SNP Genotyping and Copy Number Assay Products

Disorders for WWC1 Gene

MalaCards: The human disease database

(1) MalaCards diseases for WWC1 Gene - From: HGMD, OMIM, GTR, and GeneCards

Disorder Aliases PubMed IDs
memory quantitative trait locus
  • memryqtl
- elite association - COSMIC cancer census association via MalaCards
Search WWC1 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for WWC1

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with WWC1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for WWC1 Gene

Publications for WWC1 Gene

  1. Characterization of KIBRA, a novel WW domain-containing protein. (PMID: 12559952) Kremerskothen J … Barnekow A (Biochemical and biophysical research communications 2003) 2 3 4 22 58
  2. Prediction of the coding sequences of unidentified human genes. XII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. (PMID: 10048485) Nagase T … Ohara O (DNA research : an international journal for rapid publication of reports on genes and genomes 1998) 2 3 4 58
  3. Common exonic missense variants in the C2 domain of the human KIBRA protein modify lipid binding and cognitive performance. (PMID: 23778582) Duning K … Kremerskothen J (Translational psychiatry 2013) 3 4 58
  4. Phospho-regulation of KIBRA by CDK1 and CDC14 phosphatase controls cell-cycle progression. (PMID: 22784093) Ji M … Dong J (The Biochemical journal 2012) 3 4 58
  5. Association of KIBRA with episodic and working memory: a meta-analysis. (PMID: 23065961) Milnik A … Papassotiropoulos A (American journal of medical genetics. Part B, Neuropsychiatric genetics : the official publication of the International Society of Psychiatric Genetics 2012) 3 4 58

Products for WWC1 Gene

Sources for WWC1 Gene

Content
Loading form....