Free for academic non-profit institutions. Other users need a Commercial license

Aliases for DLX6 Gene

Aliases for DLX6 Gene

  • Distal-Less Homeobox 6 2 3 5
  • Distal-Less Homeo Box 6 2 3
  • Homeobox Protein DLX-6 3

External Ids for DLX6 Gene

Previous GeneCards Identifiers for DLX6 Gene

  • GC07P095170
  • GC07P096233
  • GC07P096247
  • GC07P096279
  • GC07P096473
  • GC07P096634
  • GC07P091222

Summaries for DLX6 Gene

Entrez Gene Summary for DLX6 Gene

  • This gene encodes a member of a homeobox transcription factor gene family similiar to the Drosophila distal-less gene. This family is comprised of at least 6 different members that encode proteins with roles in forebrain and craniofacial development. This gene is in a tail-to-tail configuration with another member of the family on the long arm of chromosome 7. [provided by RefSeq, Jul 2008]

GeneCards Summary for DLX6 Gene

DLX6 (Distal-Less Homeobox 6) is a Protein Coding gene. Diseases associated with DLX6 include Isolated Split Hand-Split Foot Malformation and Rapp-Hodgkin Syndrome. Among its related pathways are MECP2 and Associated Rett Syndrome. Gene Ontology (GO) annotations related to this gene include DNA binding transcription factor activity and sequence-specific DNA binding. An important paralog of this gene is DLX1.

Gene Wiki entry for DLX6 Gene

Additional gene information for DLX6 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for DLX6 Gene

Genomics for DLX6 Gene

GeneHancer (GH) Regulatory Elements for DLX6 Gene

Promoters and enhancers for DLX6 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH07J097004 Promoter/Enhancer 2.7 VISTA UCNEbase EPDnew Ensembl ENCODE 650.7 +0.3 272 3.1 ATF1 ZFP64 ARID4B DMAP1 ZNF2 ZNF48 YY1 GLIS2 ZNF143 NFKBIZ GC07P097004 GC07M097006 DLX6 DLX6-AS1
GH07J097016 Enhancer 1.1 FANTOM5 ENCODE 6.4 +11.5 11485 1.5 PKNOX1 GLI4 ZNF2 ZNF48 GLIS2 SP3 SP5 MXD4 REST KAT8 DLX6 DLX5 ENSG00000274709
GH07J096833 Enhancer 0.9 ENCODE 4.8 -171.7 -171657 1.4 FOXA2 MLX DNMT3B THRB ZSCAN9 RARA ETS1 ZNF614 CREM THAP11 SEM1 DLX6 MARK2P10 LOC105375414
GH07J097027 Enhancer 1.3 FANTOM5 Ensembl ENCODE 2.1 +22.1 22088 0.9 ELF3 RB1 ARID4B MZF1 BMI1 ZNF2 IRF4 RAD21 ZNF335 ZNF213 DLX5 OR7E38P DLX6 PIR43290
GH07J097013 Enhancer 0.5 FANTOM5 4.6 +7.4 7382 0.2 SP1 POLR2A ZSCAN29 EZH2 DLX6-AS1 ENSG00000274709 DLX5 DLX6 GC07M097006
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around DLX6 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the DLX6 gene promoter:
  • ATF-2
  • c-Jun
  • AP-1
  • PPAR-gamma2
  • PPAR-gamma1
  • E2F
  • E2F-4
  • E2F-3a
  • E2F-2
  • E2F-1

Genomic Locations for DLX6 Gene

Genomic Locations for DLX6 Gene
5,493 bases
Plus strand
5,493 bases
Plus strand

Genomic View for DLX6 Gene

Genes around DLX6 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
DLX6 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for DLX6 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for DLX6 Gene

Proteins for DLX6 Gene

  • Protein details for DLX6 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Homeobox protein DLX-6
    Protein Accession:
    Secondary Accessions:
    • A4D1I2
    • B3KSQ0
    • J3KR92
    • Q3ZAR6
    • Q9UPL2

    Protein attributes for DLX6 Gene

    175 amino acids
    Molecular mass:
    19708 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for DLX6 Gene


neXtProt entry for DLX6 Gene

Post-translational modifications for DLX6 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for DLX6 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • Abcam antibodies for DLX6
  • Boster Bio Antibodies for DLX6
  • Santa Cruz Biotechnology (SCBT) Antibodies for DLX6

No data available for DME Specific Peptides for DLX6 Gene

Domains & Families for DLX6 Gene

Gene Families for DLX6 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins
  • Transcription factors

Suggested Antigen Peptide Sequences for DLX6 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the distal-less homeobox family.
  • Belongs to the distal-less homeobox family.
genes like me logo Genes that share domains with DLX6: view

Function for DLX6 Gene

Molecular function for DLX6 Gene

GENATLAS Biochemistry:
Drosophila distal less homolog Dlx6,homeo domain encoding gene,expressed in brain and skeleton

Phenotypes From GWAS Catalog for DLX6 Gene

Gene Ontology (GO) - Molecular Function for DLX6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000981 RNA polymerase II transcription factor activity, sequence-specific DNA binding NAS 19274049
GO:0003677 DNA binding IEA --
GO:0003700 DNA binding transcription factor activity TAS 7907794
GO:0043565 sequence-specific DNA binding IEA --
genes like me logo Genes that share ontologies with DLX6: view
genes like me logo Genes that share phenotypes with DLX6: view

Human Phenotype Ontology for DLX6 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for DLX6 Gene

MGI Knock Outs for DLX6:

Animal Model Products

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for DLX6

Clone Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for DLX6 Gene

Localization for DLX6 Gene

Subcellular locations from UniProtKB/Swiss-Prot for DLX6 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for DLX6 gene
Compartment Confidence
nucleus 5

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nuclear bodies (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for DLX6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA --
genes like me logo Genes that share ontologies with DLX6: view

Pathways & Interactions for DLX6 Gene

genes like me logo Genes that share pathways with DLX6: view

Pathways by source for DLX6 Gene

1 BioSystems pathway for DLX6 Gene

Gene Ontology (GO) - Biological Process for DLX6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001501 skeletal system development TAS 7907794
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0006357 regulation of transcription by RNA polymerase II IEA --
GO:0007275 multicellular organism development IEA --
GO:0007399 nervous system development TAS 7907794
genes like me logo Genes that share ontologies with DLX6: view

No data available for SIGNOR curated interactions for DLX6 Gene

Drugs & Compounds for DLX6 Gene

No Compound Related Data Available

Transcripts for DLX6 Gene

mRNA/cDNA for DLX6 Gene

(1) REFSEQ mRNAs :
(6) Additional mRNA sequences :
(26) Selected AceView cDNA sequences:
(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for DLX6 Gene

Distal-less homeobox 6:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for DLX6

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for DLX6 Gene

No ASD Table

Relevant External Links for DLX6 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for DLX6 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for DLX6 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for DLX6 Gene

This gene is overexpressed in Brain - Putamen (basal ganglia) (x11.1), Brain - Nucleus accumbens (basal ganglia) (x9.8), Brain - Caudate (basal ganglia) (x9.2), and Testis (x4.1).

Protein differential expression in normal tissues from HIPED for DLX6 Gene

This gene is overexpressed in Peripheral blood mononuclear cells (65.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for DLX6 Gene

Protein tissue co-expression partners for DLX6 Gene

NURSA nuclear receptor signaling pathways regulating expression of DLX6 Gene:


SOURCE GeneReport for Unigene cluster for DLX6 Gene:


Evidence on tissue expression from TISSUES for DLX6 Gene

  • Nervous system(3.6)
genes like me logo Genes that share expression patterns with DLX6: view

No data available for mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for DLX6 Gene

Orthologs for DLX6 Gene

This gene was present in the common ancestor of animals.

Orthologs for DLX6 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia DLX6 34 33
  • 99.09 (n)
(Canis familiaris)
Mammalia DLX6 34 33
  • 95.21 (n)
(Rattus norvegicus)
Mammalia Dlx6 33
  • 94.07 (n)
(Monodelphis domestica)
Mammalia DLX6 34
  • 93 (a)
(Mus musculus)
Mammalia Dlx6 16 34 33
  • 92.72 (n)
(Bos Taurus)
Mammalia DLX6 34 33
  • 90.28 (n)
(Ornithorhynchus anatinus)
Mammalia DLX6 34
  • 89 (a)
(Gallus gallus)
Aves DLX6 34 33
  • 82.65 (n)
(Anolis carolinensis)
Reptilia DLX6 34
  • 88 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100494171 33
  • 58.68 (n)
Str.15888 33
African clawed frog
(Xenopus laevis)
Amphibia Xl.262 33
(Danio rerio)
Actinopterygii dlx6a 34 33 33
  • 71.26 (n)
fruit fly
(Drosophila melanogaster)
Insecta Dll 34
  • 28 (a)
(Caenorhabditis elegans)
Secernentea ceh-43 34
  • 30 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 25 (a)
Species where no ortholog for DLX6 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for DLX6 Gene

Gene Tree for DLX6 (if available)
Gene Tree for DLX6 (if available)
Evolutionary constrained regions (ECRs) for DLX6: view image

Paralogs for DLX6 Gene

Paralogs for DLX6 Gene

(20) SIMAP similar genes for DLX6 Gene using alignment to 2 proteins:

  • G3V471_HUMAN
genes like me logo Genes that share paralogs with DLX6: view

Variants for DLX6 Gene

Sequence variations from dbSNP and Humsavar for DLX6 Gene

SNP ID Clin Chr 07 pos Variation AA Info Type
rs1000787946 -- 97,008,888(+) T/C intron_variant
rs1000842059 -- 97,009,262(+) A/G/T intron_variant
rs1000974937 -- 97,004,870(+) A/T upstream_transcript_variant
rs1001300592 -- 97,005,043(+) C/A/G upstream_transcript_variant
rs1001603219 -- 97,006,242(+) CACCACCACCAGCACCACCACCA/CACCACCACCA coding_sequence_variant, inframe_deletion

Structural Variations from Database of Genomic Variants (DGV) for DLX6 Gene

Variant ID Type Subtype PubMed ID
nsv824221 CNV gain 20364138

Variation tolerance for DLX6 Gene

Residual Variation Intolerance Score: 56.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 6.59; 78.05% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for DLX6 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for DLX6 Gene

Disorders for DLX6 Gene

MalaCards: The human disease database

(7) MalaCards diseases for DLX6 Gene - From: HGMD, Orphanet, DISEASES, Novoseek, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search DLX6 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for DLX6

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with DLX6: view

No data available for UniProtKB/Swiss-Prot and Genatlas for DLX6 Gene

Publications for DLX6 Gene

  1. Cloning and characterization of two members of the vertebrate Dlx gene family. (PMID: 7907794) Simeone A … Huebner K (Proceedings of the National Academy of Sciences of the United States of America 1994) 2 3 4 22 58
  2. Expression analysis and mutation detection of DLX5 and DLX6 in autism. (PMID: 19195802) Nakashima N … Momoi MY (Brain & development 2010) 3 22 58
  3. Maternal genes and facial clefts in offspring: a comprehensive search for genetic associations in two population-based cleft studies from Scandinavia. (PMID: 20634891) Jugessur A … Murray JC (PloS one 2010) 3 44 58
  4. High-density association study of 383 candidate genes for volumetric BMD at the femoral neck and lumbar spine among older men. (PMID: 19453261) Yerges LM … MrOS Research Group (Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 2009) 3 44 58
  5. DLX5 and DLX6 expression is biallelic and not modulated by MeCP2 deficiency. (PMID: 17701895) Schüle B … Francke U (American journal of human genetics 2007) 3 22 58

Products for DLX6 Gene

Sources for DLX6 Gene

Loading form....