Free for academic non-profit institutions. Other users need a Commercial license

Aliases for CENPF Gene

Aliases for CENPF Gene

  • Centromere Protein F 2 3 3 5
  • Mitosin 2 3 4
  • Centromere Protein F, 350/400kDa 2 3
  • Kinetochore Protein CENPF 3 4
  • AH Antigen 3 4
  • Centromere Protein F, 350/400kDa (Mitosin) 2
  • Cell-Cycle-Dependent 350K Nuclear Protein 3
  • CENP-F Kinetochore Protein 3
  • PRO1779 3
  • CILD31 3
  • STROMS 3
  • CENP-F 4
  • Hcp-1 3
  • CENF 3

External Ids for CENPF Gene

Previous GeneCards Identifiers for CENPF Gene

  • GC01P213428
  • GC01P210596
  • GC01P211392
  • GC01P211833
  • GC01P211165
  • GC01P212843
  • GC01P214776
  • GC01P185450

Summaries for CENPF Gene

Entrez Gene Summary for CENPF Gene

  • This gene encodes a protein that associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. In late G2 the protein associates with the kinetochore and maintains this association through early anaphase. It localizes to the spindle midzone and the intracellular bridge in late anaphase and telophase, respectively, and is thought to be subsequently degraded. The localization of this protein suggests that it may play a role in chromosome segregation during mitotis. It is thought to form either a homodimer or heterodimer. Autoantibodies against this protein have been found in patients with cancer or graft versus host disease. [provided by RefSeq, Jul 2008]

GeneCards Summary for CENPF Gene

CENPF (Centromere Protein F) is a Protein Coding gene. Diseases associated with CENPF include Stromme Syndrome and Intestinal Atresia. Among its related pathways are Cell Cycle, Mitotic and Regulation of PLK1 Activity at G2/M Transition. Gene Ontology (GO) annotations related to this gene include protein homodimerization activity and transcription factor binding.

UniProtKB/Swiss-Prot for CENPF Gene

  • Required for kinetochore function and chromosome segregation in mitosis. Required for kinetochore localization of dynein, LIS1, NDE1 and NDEL1. Regulates recycling of the plasma membrane by acting as a link between recycling vesicles and the microtubule network though its association with STX4 and SNAP25. Acts as a potential inhibitor of pocket protein-mediated cellular processes during development by regulating the activity of RB proteins during cell division and proliferation. May play a regulatory or permissive role in the normal embryonic cardiomyocyte cell cycle and in promoting continued mitosis in transformed, abnormally dividing neonatal cardiomyocytes. Interaction with RB directs embryonic stem cells toward a cardiac lineage. Involved in the regulation of DNA synthesis and hence cell cycle progression, via its C-terminus. Has a potential role regulating skeletal myogenesis and in cell differentiation in embryogenesis. Involved in dendritic cell regulation of T-cell immunity against chlamydia.

Gene Wiki entry for CENPF Gene

Additional gene information for CENPF Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for CENPF Gene

Genomics for CENPF Gene

GeneHancer (GH) Regulatory Elements for CENPF Gene

Promoters and enhancers for CENPF Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH01J214602 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 658.1 +0.7 685 3.2 PKNOX1 CLOCK SMAD1 ARNT ARID4B SIN3A FEZF1 DMAP1 YY1 SLC30A9 CENPF SMYD2 ABHD17AP3
GH01J214437 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 11.2 -163.1 -163080 4.9 HDGF PKNOX1 FOXA2 SMAD1 ARNT ARID4B SIN3A FEZF1 DMAP1 ZNF2 CENPF PTPN14 ABHD17AP3 SMYD2 GC01M214483 ENSG00000228470
GH01J214425 Enhancer 1.5 FANTOM5 Ensembl ENCODE dbSUPER 10.5 -175.0 -175020 5.9 HDGF PKNOX1 BMI1 FEZF1 YBX1 KLF5 IRF4 ATF7 FOS ETV6 CENPF PTPN14 ABHD17AP3 SMYD2 PROX1 KCNK2 GC01M214483 ENSG00000228470
GH01J214569 Enhancer 1 ENCODE dbSUPER 11.3 -30.7 -30729 6.7 JUN ZSCAN4 RFX5 ZFHX2 GATA3 ZNF316 ZNF366 ZSCAN5C SCRT2 SMARCC2 PTPN14 CENPF
GH01J214364 Enhancer 0.6 ENCODE dbSUPER 10 -238.6 -238566 0.2 FOSL1 ZSCAN29 ZNF24 CENPF ENSG00000228470 GC01M214483 PTPN14
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around CENPF on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the CENPF gene promoter:
  • HTF
  • AhR
  • Meis-1b
  • Meis-1
  • HOXA9B
  • HOXA9
  • Pax-2
  • Pax-2a
  • CBF(2)
  • CBF-A

Genomic Locations for CENPF Gene

Genomic Locations for CENPF Gene
61,410 bases
Plus strand
61,400 bases
Plus strand

Genomic View for CENPF Gene

Genes around CENPF on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
CENPF Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for CENPF Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for CENPF Gene

Proteins for CENPF Gene

  • Protein details for CENPF Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Centromere protein F
    Protein Accession:
    Secondary Accessions:
    • Q13171
    • Q13246
    • Q5VVM7

    Protein attributes for CENPF Gene

    3210 amino acids
    Molecular mass:
    367764 Da
    Quaternary structure:
    • Interacts with and STX4 (via C-terminus) (By similarity). Interacts (via N-terminus) with RBL1, RBL2 and SNAP25 (By similarity). Self-associates. Interacts with CENP-E and BUBR1 (via C-terminus). Interacts (via C-terminus) with NDE1, NDEL1 and RB1.

neXtProt entry for CENPF Gene

Post-translational modifications for CENPF Gene

  • Hyperphosphorylated during mitosis.
  • Ubiquitination at posLast=29402940, Lys2132, Lys1906, posLast=14101410, posLast=13411341, posLast=10881088, posLast=10221022, posLast=956956, Lys823, Lys770, Lys697, Lys555, Lys527, posLast=513513, Lys457, posLast=356356, Lys314, posLast=293293, Lys223, and Lys19
  • Modification sites at PhosphoSitePlus

Other Protein References for CENPF Gene

No data available for DME Specific Peptides for CENPF Gene

Domains & Families for CENPF Gene

Gene Families for CENPF Gene

Human Protein Atlas (HPA):
  • Cancer-related genes
  • Disease related genes
  • Plasma proteins
  • Predicted intracellular proteins

Protein Domains for CENPF Gene

Suggested Antigen Peptide Sequences for CENPF Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the centromere protein F family.
  • Belongs to the centromere protein F family.
genes like me logo Genes that share domains with CENPF: view

Function for CENPF Gene

Molecular function for CENPF Gene

UniProtKB/Swiss-Prot Function:
Required for kinetochore function and chromosome segregation in mitosis. Required for kinetochore localization of dynein, LIS1, NDE1 and NDEL1. Regulates recycling of the plasma membrane by acting as a link between recycling vesicles and the microtubule network though its association with STX4 and SNAP25. Acts as a potential inhibitor of pocket protein-mediated cellular processes during development by regulating the activity of RB proteins during cell division and proliferation. May play a regulatory or permissive role in the normal embryonic cardiomyocyte cell cycle and in promoting continued mitosis in transformed, abnormally dividing neonatal cardiomyocytes. Interaction with RB directs embryonic stem cells toward a cardiac lineage. Involved in the regulation of DNA synthesis and hence cell cycle progression, via its C-terminus. Has a potential role regulating skeletal myogenesis and in cell differentiation in embryogenesis. Involved in dendritic cell regulation of T-cell immunity against chlamydia.
GENATLAS Biochemistry:
centromere protein F,component of the outer kinetochore plate

Phenotypes From GWAS Catalog for CENPF Gene

Gene Ontology (GO) - Molecular Function for CENPF Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003682 chromatin binding NAS 9891037
GO:0005515 protein binding IPI 7651420
GO:0008022 protein C-terminus binding IPI 7642639
GO:0008134 transcription factor binding IPI 15677469
GO:0042803 protein homodimerization activity IPI 7642639
genes like me logo Genes that share ontologies with CENPF: view
genes like me logo Genes that share phenotypes with CENPF: view

Human Phenotype Ontology for CENPF Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for CENPF Gene

Localization for CENPF Gene

Subcellular locations from UniProtKB/Swiss-Prot for CENPF Gene

Cytoplasm, perinuclear region. Nucleus matrix. Chromosome, centromere, kinetochore. Cytoplasm, cytoskeleton, spindle. Note=Relocalizes to the kinetochore/centromere (coronal surface of the outer plate) and the spindle during mitosis. Observed in nucleus during interphase but not in the nucleolus. At metaphase becomes localized to areas including kinetochore and mitotic apparatus as well as cytoplasm. By telophase, is concentrated within the intracellular bridge at either side of the mid-body.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for CENPF gene
Compartment Confidence
cytoskeleton 5
nucleus 5
cytosol 5

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for CENPF Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000775 chromosome, centromeric region IEA,IDA 7542657
GO:0000776 kinetochore IDA,IEA 7542657
GO:0000777 condensed chromosome kinetochore IEA --
GO:0000785 colocalizes_with chromatin NAS 9891037
GO:0000922 spindle pole IDA 7542657
genes like me logo Genes that share ontologies with CENPF: view

Pathways & Interactions for CENPF Gene

genes like me logo Genes that share pathways with CENPF: view

Pathways by source for CENPF Gene

1 Cell Signaling Technology pathway for CENPF Gene

Gene Ontology (GO) - Biological Process for CENPF Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000278 mitotic cell cycle IMP 7542657
GO:0001822 kidney development IMP 25564561
GO:0007049 cell cycle IEA --
GO:0007059 chromosome segregation NAS 7542657
GO:0007062 sister chromatid cohesion TAS --
genes like me logo Genes that share ontologies with CENPF: view

No data available for SIGNOR curated interactions for CENPF Gene

Drugs & Compounds for CENPF Gene

(4) Drugs for CENPF Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
genes like me logo Genes that share compounds with CENPF: view

Transcripts for CENPF Gene

mRNA/cDNA for CENPF Gene

Unigene Clusters for CENPF Gene

Centromere protein F, 350/400kDa:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for CENPF Gene

No ASD Table

Relevant External Links for CENPF Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for CENPF Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for CENPF Gene

mRNA differential expression in normal tissues according to GTEx for CENPF Gene

This gene is overexpressed in Testis (x4.8) and Esophagus - Mucosa (x4.2).

Protein differential expression in normal tissues from HIPED for CENPF Gene

This gene is overexpressed in Nasal epithelium (43.0) and Bone marrow stromal cell (8.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for CENPF Gene

NURSA nuclear receptor signaling pathways regulating expression of CENPF Gene:


SOURCE GeneReport for Unigene cluster for CENPF Gene:


Evidence on tissue expression from TISSUES for CENPF Gene

  • Liver(3.4)

Phenotype-based relationships between genes and organs from Gene ORGANizer for CENPF Gene

Germ Layers:
  • ectoderm
  • endoderm
  • digestive
  • endocrine
  • integumentary
  • nervous
  • skeleton
Head and neck:
  • brain
  • cerebellum
  • cerebrospinal fluid
  • chin
  • ear
  • eye
  • face
  • head
  • jaw
  • mandible
  • maxilla
  • meninges
  • mouth
  • nose
  • outer ear
  • skull
  • biliary tract
  • duodenum
  • intestine
  • liver
  • pancreas
  • small intestine
  • stomach
  • skin
genes like me logo Genes that share expression patterns with CENPF: view

No data available for Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for CENPF Gene

Orthologs for CENPF Gene

This gene was present in the common ancestor of animals.

Orthologs for CENPF Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia CENPF 34 33
  • 99.28 (n)
(Bos Taurus)
Mammalia CENPF 34 33
  • 84.66 (n)
(Canis familiaris)
Mammalia -- 34
  • 84 (a)
  • 83.79 (n)
-- 34
  • 71 (a)
(Rattus norvegicus)
Mammalia Cenpf 33
  • 77.45 (n)
(Mus musculus)
Mammalia Cenpf 16 34 33
  • 75.67 (n)
(Ornithorhynchus anatinus)
Mammalia CENPF 34
  • 54 (a)
(Monodelphis domestica)
Mammalia CENPF 34
  • 52 (a)
(Gallus gallus)
Aves CENPF 34 33
  • 59.13 (n)
(Anolis carolinensis)
Reptilia CENPF 34
  • 40 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia cenpf 33
  • 53.33 (n)
(Danio rerio)
Actinopterygii cenpf 34
  • 29 (a)
(Caenorhabditis elegans)
Secernentea C02F12.7 35
  • 21 (a)
Species where no ortholog for CENPF was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for CENPF Gene

Gene Tree for CENPF (if available)
Gene Tree for CENPF (if available)
Evolutionary constrained regions (ECRs) for CENPF: view image

Paralogs for CENPF Gene

No data available for Paralogs for CENPF Gene

Variants for CENPF Gene

Sequence variations from dbSNP and Humsavar for CENPF Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
rs144237457 uncertain-significance, not specified, not provided 214,641,955(+) A/G coding_sequence_variant, missense_variant
rs200976140 pathogenic, Stromme syndrome 214,641,072(+) G/T coding_sequence_variant, stop_gained
rs367624766 pathogenic, Stromme syndrome 214,640,082(+) G/A/T coding_sequence_variant, missense_variant, stop_gained
rs376767238 pathogenic, Stromme syndrome 214,620,653(+) A/C splice_acceptor_variant
rs757575602 pathogenic, Stromme syndrome 214,614,834(+) TGAAAATGAAAAAACCGAGGGTACAAACCTGAAAA/TGAAAA coding_sequence_variant, frameshift

Structural Variations from Database of Genomic Variants (DGV) for CENPF Gene

Variant ID Type Subtype PubMed ID
dgv574n100 CNV gain 25217958
esv1007536 CNV insertion 20482838
esv2145066 CNV deletion 18987734
esv27146 CNV gain+loss 19812545
esv2722628 CNV deletion 23290073
esv29119 CNV loss 19812545
esv3578422 CNV loss 25503493
esv3588789 CNV loss 21293372
nsv160230 CNV deletion 16902084
nsv436780 CNV insertion 17901297
nsv549181 CNV loss 21841781

Variation tolerance for CENPF Gene

Residual Variation Intolerance Score: 98.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 20.93; 99.19% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for CENPF Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for CENPF Gene

Disorders for CENPF Gene

MalaCards: The human disease database

(4) MalaCards diseases for CENPF Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
stromme syndrome
  • stroms
intestinal atresia
graft-versus-host disease
  • graft-versus-host disease, susceptibility to
  • microcephalus
- elite association - COSMIC cancer census association via MalaCards
Search CENPF in MalaCards View complete list of genes associated with diseases


  • Stromme syndrome (STROMS) [MIM:243605]: An autosomal recessive congenital disorder characterized by intestinal atresia, ocular anomalies, microcephaly, and renal and cardiac abnormalities in some patients. The disease has features of a ciliopathy, and lethality in early childhood is observed in severe cases. {ECO:0000269 PubMed:25564561, ECO:0000269 PubMed:26820108}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for CENPF

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with CENPF: view

No data available for Genatlas for CENPF Gene

Publications for CENPF Gene

  1. Mitosin/CENP-F is a conserved kinetochore protein subjected to cytoplasmic dynein-mediated poleward transport. (PMID: 12974617) Yang ZY … Zhu XL (Cell research 2003) 3 4 22 58
  2. Farnesyl transferase inhibitors block the farnesylation of CENP-E and CENP-F and alter the association of CENP-E with the microtubules. (PMID: 10852915) Ashar HR … Kirschmeier P (The Journal of biological chemistry 2000) 3 4 22 58
  3. Characterization of a novel 350-kilodalton nuclear phosphoprotein that is specifically involved in mitotic-phase progression. (PMID: 7651420) Zhu X … Lee WH (Molecular and cellular biology 1995) 3 4 22 58
  4. CENP-F is a protein of the nuclear matrix that assembles onto kinetochores at late G2 and is rapidly degraded after mitosis. (PMID: 7542657) Liao H … Yen TJ (The Journal of cell biology 1995) 3 4 22 58
  5. Chromosomal localization of the genes encoding the kinetochore proteins CENPE and CENPF to human chromosomes 4q24-->q25 and 1q32-->q41, respectively, by fluorescence in situ hybridization. (PMID: 7851898) Testa JR … Yen TJ (Genomics 1994) 2 3 22 58

Products for CENPF Gene

Sources for CENPF Gene

Loading form....