Free for academic non-profit institutions. Other users need a Commercial license

Aliases for ALAS1 Gene

Aliases for ALAS1 Gene

  • 5'-Aminolevulinate Synthase 1 2 3
  • Aminolevulinate, Delta-, Synthase 1 2 3
  • Delta-Aminolevulinate Synthase 1 3 4
  • 5-Aminolevulinic Acid Synthase 1 3 4
  • Delta-ALA Synthase 1 3 4
  • ALAS-H 3 4
  • ALAS3 3 4
  • ALASH 3 4
  • 5-Aminolevulinate Synthase, Nonspecific, Mitochondrial 3
  • Migration-Inducing Protein 4 3
  • 5-Aminolevulinate Synthase 1 5
  • EC 4
  • MIG4 3
  • ALAS 3

External Ids for ALAS1 Gene

Previous HGNC Symbols for ALAS1 Gene

  • ALAS3
  • ALAS

Previous GeneCards Identifiers for ALAS1 Gene

  • GC03P051324
  • GC03P051484
  • GC03P052088
  • GC03P052190
  • GC03P052207

Summaries for ALAS1 Gene

Entrez Gene Summary for ALAS1 Gene

  • This gene encodes the mitochondrial enzyme which is catalyzes the rate-limiting step in heme (iron-protoporphyrin) biosynthesis. The enzyme encoded by this gene is the housekeeping enzyme; a separate gene encodes a form of the enzyme that is specific for erythroid tissue. The level of the mature encoded protein is regulated by heme: high levels of heme down-regulate the mature enzyme in mitochondria while low heme levels up-regulate. A pseudogene of this gene is located on chromosome 12. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]

GeneCards Summary for ALAS1 Gene

ALAS1 (5'-Aminolevulinate Synthase 1) is a Protein Coding gene. Diseases associated with ALAS1 include Anemia, Sideroblastic, 1 and Acute Porphyria. Among its related pathways are Organelle biogenesis and maintenance and Metabolism. Gene Ontology (GO) annotations related to this gene include pyridoxal phosphate binding and 5-aminolevulinate synthase activity. An important paralog of this gene is ALAS2.

Gene Wiki entry for ALAS1 Gene

Additional gene information for ALAS1 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for ALAS1 Gene

Genomics for ALAS1 Gene

GeneHancer (GH) Regulatory Elements for ALAS1 Gene

Promoters and enhancers for ALAS1 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH03J052194 Promoter/Enhancer 2.4 EPDnew Ensembl ENCODE dbSUPER 650.7 -1.3 -1265 5.4 HDGF ZFP64 ARID4B SIN3A DMAP1 GLI4 ZNF2 ZNF48 YY1 POLR2B ALAS1 PBRM1 RFT1 ABHD14B RPL29 STIMATE RRP9 GLYCTK NT5DC2 ALDOAP1
GH03J052182 Enhancer 1 FANTOM5 dbSUPER 7.1 -15.8 -15775 0.4 FOXA2 ZFP64 THRB RAD21 RARA EGR1 CREM RXRA REST NR2F2 POC1A ALAS1 ALDOAP1
GH03J051962 Enhancer 0.7 ENCODE dbSUPER 4.1 -234.3 -234262 2.2 POLR2A GLIS1 SIN3A EGR2 ZBTB17 GC03P051963 ALAS1 GPR62 ENSG00000272762 PCBP4
GH03J052085 Enhancer 0.4 ENCODE 4.1 -112.0 -112043 0.2 IKZF1 EBF1 RUNX3 ALAS1 LINC00696 POC1A
GH03J052185 Enhancer 0.4 FANTOM5 1.7 -12.0 -12003 0.2 POLR2A CBFA2T3 ZNF24 POC1A DUSP7 GLYCTK WDR82 MIR135A1 GLYCTK-AS1 PCBP4 GPR62 ALAS1 ALDOAP1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around ALAS1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the ALAS1 gene promoter:
  • AP-1
  • c-Jun
  • ATF-2

Genomic Locations for ALAS1 Gene

Genomic Locations for ALAS1 Gene
16,245 bases
Plus strand
16,242 bases
Plus strand

Genomic View for ALAS1 Gene

Genes around ALAS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
ALAS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for ALAS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for ALAS1 Gene

Proteins for ALAS1 Gene

  • Protein details for ALAS1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    5-aminolevulinate synthase, nonspecific, mitochondrial
    Protein Accession:

    Protein attributes for ALAS1 Gene

    640 amino acids
    Molecular mass:
    70581 Da
    Name=pyridoxal 5-phosphate; Xref=ChEBI:CHEBI:597326;
    Quaternary structure:
    • Homodimer.
    • There are two delta-ALA synthases in vertebrates: an erythroid- specific form and one (housekeeping) which is expressed in all tissues.
    • Sequence=CAA68506.1; Type=Frameshift; Positions=Several; Evidence={ECO:0000305};

    Alternative splice isoforms for ALAS1 Gene


neXtProt entry for ALAS1 Gene

Post-translational modifications for ALAS1 Gene

  • Ubiquitination at Lys539
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for ALAS1 Gene

Domains & Families for ALAS1 Gene

Gene Families for ALAS1 Gene

Human Protein Atlas (HPA):
  • Enzymes
  • Plasma proteins
  • Predicted intracellular proteins

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the class-II pyridoxal-phosphate-dependent aminotransferase family.
  • Belongs to the class-II pyridoxal-phosphate-dependent aminotransferase family.
genes like me logo Genes that share domains with ALAS1: view

Function for ALAS1 Gene

Molecular function for ALAS1 Gene

UniProtKB/Swiss-Prot CatalyticActivity:
Succinyl-CoA + glycine = 5-aminolevulinate + CoA + CO(2).
GENATLAS Biochemistry:
aminolevulinate,delta-,synthase 1,housekeeping gene,liver,mitochondrial,pyridoxal dependent,catalyzing the first step of porphyrin biosynthesis

Enzyme Numbers (IUBMB) for ALAS1 Gene

Gene Ontology (GO) - Molecular Function for ALAS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003870 5-aminolevulinate synthase activity TAS --
GO:0005515 protein binding IPI 21516116
GO:0016740 transferase activity IEA --
GO:0016746 transferase activity, transferring acyl groups IEA --
GO:0030170 pyridoxal phosphate binding IEA --
genes like me logo Genes that share ontologies with ALAS1: view
genes like me logo Genes that share phenotypes with ALAS1: view

Animal Models for ALAS1 Gene

MGI Knock Outs for ALAS1:

Animal Model Products

miRNA for ALAS1 Gene

miRTarBase miRNAs that target ALAS1

Clone Products

No data available for Phenotypes From GWAS Catalog , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for ALAS1 Gene

Localization for ALAS1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for ALAS1 Gene

Mitochondrion matrix.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for ALAS1 gene
Compartment Confidence
mitochondrion 5
nucleus 5
cytosol 5

Subcellular locations from the

Human Protein Atlas (HPA)
  • Mitochondria (4)
  • Nucleoplasm (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for ALAS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005654 nucleoplasm IDA --
GO:0005739 mitochondrion IEA,IDA --
GO:0005759 mitochondrial matrix TAS --
GO:0005829 cytosol IDA --
genes like me logo Genes that share ontologies with ALAS1: view

Pathways & Interactions for ALAS1 Gene

genes like me logo Genes that share pathways with ALAS1: view

UniProtKB/Swiss-Prot P13196-HEM1_HUMAN

  • Pathway: Porphyrin-containing compound metabolism; protoporphyrin-IX biosynthesis; 5-aminolevulinate from glycine: step 1/1.

Gene Ontology (GO) - Biological Process for ALAS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006778 porphyrin-containing compound metabolic process IEA --
GO:0006782 protoporphyrinogen IX biosynthetic process IEA --
GO:0006783 heme biosynthetic process TAS --
GO:0007005 mitochondrion organization TAS --
GO:0008152 metabolic process IEA --
genes like me logo Genes that share ontologies with ALAS1: view

No data available for SIGNOR curated interactions for ALAS1 Gene

Drugs & Compounds for ALAS1 Gene

(16) Drugs for ALAS1 Gene - From: DrugBank, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Glycine Approved, Vet_approved Nutra Full agonist, Agonist, Target 254
Pyridoxal Phosphate Approved, Investigational Nutra Target, Target, cofactor 17
Aminolevulinic acid Approved Pharma 170
Carbon dioxide Approved, Investigational, Vet_approved Pharma 0
Succinyl-CoA Experimental Pharma 0

(10) Additional Compounds for ALAS1 Gene - From: HMDB and Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • AcCoA
  • Acetyl coenzyme A
  • S-Acetyl-CoA
  • S-Acetyl-coenzyme A
  • Ac-CoA
  • Formyl coenzyme A
  • Formyl-coenzyme A
L-2-Amino-3-oxobutanoic acid
  • (S)-2-amino-3-Oxobutanoic acid
  • 2-amino-3-KETOBUTYRIC ACID
  • L-2-amino-3-Oxobutanoate
  • L-2-amino-Acetoacetate
  • (S)-2-amino-3-Oxobutanoate
genes like me logo Genes that share compounds with ALAS1: view

Transcripts for ALAS1 Gene

Unigene Clusters for ALAS1 Gene

Aminolevulinate, delta-, synthase 1:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for ALAS1 Gene

ExUns: 1a · 1b · 1c · 1d ^ 2 ^ 3a · 3b · 3c ^ 4a · 4b ^ 5 ^ 6a · 6b ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13a · 13b
SP1: -
SP2: - -
SP3: - - -
SP4: - -
SP5: - -
SP6: - -

Relevant External Links for ALAS1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for ALAS1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for ALAS1 Gene

mRNA differential expression in normal tissues according to GTEx for ALAS1 Gene

This gene is overexpressed in Adrenal Gland (x12.3) and Liver (x4.2).

Protein differential expression in normal tissues from HIPED for ALAS1 Gene

This gene is overexpressed in Fetal ovary (17.6), Fetal testis (17.5), Adrenal (16.8), and Liver (11.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for ALAS1 Gene

Protein tissue co-expression partners for ALAS1 Gene

NURSA nuclear receptor signaling pathways regulating expression of ALAS1 Gene:


SOURCE GeneReport for Unigene cluster for ALAS1 Gene:


Evidence on tissue expression from TISSUES for ALAS1 Gene

  • Liver(4.7)
  • Muscle(4.4)
  • Nervous system(4.4)
  • Blood(2.7)
  • Adrenal gland(2.5)
genes like me logo Genes that share expression patterns with ALAS1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for ALAS1 Gene

Orthologs for ALAS1 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for ALAS1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia ALAS1 34 33
  • 99.58 (n)
(Canis familiaris)
Mammalia ALAS1 34 33
  • 91.72 (n)
(Monodelphis domestica)
Mammalia ALAS1 34
  • 89 (a)
(Bos Taurus)
Mammalia ALAS1 34 33
  • 88.39 (n)
(Ornithorhynchus anatinus)
Mammalia ALAS1 34
  • 88 (a)
(Mus musculus)
Mammalia Alas1 16 34 33
  • 87.5 (n)
(Rattus norvegicus)
Mammalia Alas1 33
  • 87.4 (n)
(Gallus gallus)
Aves ALAS1 34 33
  • 76.57 (n)
(Anolis carolinensis)
Reptilia ALAS1 34
  • 85 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia alas1 33
  • 72.76 (n)
Str.5235 33
African clawed frog
(Xenopus laevis)
Amphibia MGC68700 33
(Danio rerio)
Actinopterygii alas1 34 33 33
  • 70.1 (n)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.8381 33
fruit fly
(Drosophila melanogaster)
Insecta Alas 34 35
  • 53 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes HEM1 34
  • 36 (a)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.8623 34
  • 56 (a)
Cin.9850 33
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.9850 33
Species where no ortholog for ALAS1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for ALAS1 Gene

Gene Tree for ALAS1 (if available)
Gene Tree for ALAS1 (if available)
Evolutionary constrained regions (ECRs) for ALAS1: view image

Paralogs for ALAS1 Gene

Paralogs for ALAS1 Gene

(1) SIMAP similar genes for ALAS1 Gene using alignment to 4 proteins:

  • H7C4H7_HUMAN
  • H7C5B0_HUMAN
  • Q5JAM2_HUMAN Pseudogenes for ALAS1 Gene

genes like me logo Genes that share paralogs with ALAS1: view

Variants for ALAS1 Gene

Sequence variations from dbSNP and Humsavar for ALAS1 Gene

SNP ID Clin Chr 03 pos Variation AA Info Type
rs1000023450 -- 52,209,986(+) G/A intron_variant
rs1000263455 -- 52,196,627(+) T/C upstream_transcript_variant
rs1000338998 -- 52,196,844(+) G/C upstream_transcript_variant
rs1000521004 -- 52,212,416(+) C/G coding_sequence_variant, missense_variant
rs1000544499 -- 52,203,479(+) TGCAATGAGTC/TGCAATGAGTCTGCAATGAGTC intron_variant

Structural Variations from Database of Genomic Variants (DGV) for ALAS1 Gene

Variant ID Type Subtype PubMed ID
nsv954858 CNV deletion 24416366
nsv834695 CNV loss 17160897
nsv834694 CNV gain 17160897
nsv590301 CNV loss 21841781
nsv519445 CNV gain+loss 19592680
nsv508926 CNV insertion 20534489
nsv508218 CNV deletion 20534489
nsv470572 CNV loss 18288195
nsv460537 CNV loss 19166990

Variation tolerance for ALAS1 Gene

Residual Variation Intolerance Score: 29.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.71; 46.45% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for ALAS1 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for ALAS1 Gene

Disorders for ALAS1 Gene

MalaCards: The human disease database

(7) MalaCards diseases for ALAS1 Gene - From: HGMD, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
anemia, sideroblastic, 1
  • sidba1
acute porphyria
  • hepatic porphyria
porphyria, acute intermittent
  • aip
  • disorder of porphyrin and hem metabolism
sideroblastic anemia
  • anemia sideroblastic
- elite association - COSMIC cancer census association via MalaCards
Search ALAS1 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for ALAS1

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with ALAS1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for ALAS1 Gene

Publications for ALAS1 Gene

  1. Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PMID: 20628086) Bailey SD … DREAM investigators (Diabetes care 2010) 3 44 58
  2. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression. (PMID: 20877624) Hendrickson SL … O'Brien SJ (PloS one 2010) 3 44 58
  3. Down-regulation of aminolevulinate synthase, the rate-limiting enzyme for heme biosynthesis in Alzheimer's disease. (PMID: 19477221) Dwyer BE … Zhu X (Neuroscience letters 2009) 3 22 58
  4. Functional analysis of the 5' regulatory region of the 5-aminolevulinate synthase (ALAS1) gene in response to estrogen. (PMID: 19656447) du Plessis N … Warnich L (Cellular and molecular biology (Noisy-le-Grand, France) 2009) 3 22 58
  5. Differential regulation of human ALAS1 mRNA and protein levels by heme and cobalt protoporphyrin. (PMID: 18719978) Zheng J … Bonkovsky HL (Molecular and cellular biochemistry 2008) 3 22 58

Products for ALAS1 Gene

Sources for ALAS1 Gene

Loading form....