The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is very conserved in evolution, and the protein encoded by this gene... See more...

Aliases for WNT1 Gene

Aliases for WNT1 Gene

  • Wnt Family Member 1 2 3 5
  • Proto-Oncogene Int-1 Homolog 3 4
  • Proto-Oncogene Wnt-1 3 4
  • INT1 3 4
  • Wingless-Type MMTV Integration Site Family, Member 1 (Oncogene INT1) 3
  • Wingless-Type MMTV Integration Site Family, Member 1 2
  • Wingless-Type MMTV Integration Site Family Member 1 3
  • BMND16 3
  • OI15 3

External Ids for WNT1 Gene

Previous HGNC Symbols for WNT1 Gene

  • INT1

Previous GeneCards Identifiers for WNT1 Gene

  • GC12M049438
  • GC12P049088
  • GC12P047658
  • GC12P049372
  • GC12P046403
  • GC12P048981
  • GC12P048985
  • GC12P049022
  • GC12P049026
  • GC12P048988
  • GC12P048989
  • GC12P048990
  • GC12P048993
  • GC12P049003
  • GC12P049007
  • GC12P049011
  • GC12P049016

Summaries for WNT1 Gene

Entrez Gene Summary for WNT1 Gene

  • The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is very conserved in evolution, and the protein encoded by this gene is known to be 98% identical to the mouse Wnt1 protein at the amino acid level. The studies in mouse indicate that the Wnt1 protein functions in the induction of the mesencephalon and cerebellum. This gene was originally considered as a candidate gene for Joubert syndrome, an autosomal recessive disorder with cerebellar hypoplasia as a leading feature. However, further studies suggested that the gene mutations might not have a significant role in Joubert syndrome. This gene is clustered with another family member, WNT10B, in the chromosome 12q13 region. [provided by RefSeq, Jul 2008]

GeneCards Summary for WNT1 Gene

WNT1 (Wnt Family Member 1) is a Protein Coding gene. Diseases associated with WNT1 include Osteogenesis Imperfecta, Type Xv and Bone Mineral Density Quantitative Trait Locus 16. Among its related pathways are Transcription Androgen Receptor nuclear signaling and Wnt Signaling Pathway and Pluripotency. Gene Ontology (GO) annotations related to this gene include signaling receptor binding and transcription regulatory region DNA binding. An important paralog of this gene is WNT3.

UniProtKB/Swiss-Prot Summary for WNT1 Gene

  • Ligand for members of the frizzled family of seven transmembrane receptors (Probable). Acts in the canonical Wnt signaling pathway by promoting beta-catenin-dependent transcriptional activation (PubMed:23499309, PubMed:26902720, PubMed:28528193, PubMed:23656646). In some developmental processes, is also a ligand for the coreceptor RYK, thus triggering Wnt signaling (By similarity). Plays an essential role in the development of the embryonic brain and central nervous system (CNS) (By similarity). Has a role in osteoblast function, bone development and bone homeostasis (PubMed:23499309, PubMed:23656646).

Gene Wiki entry for WNT1 Gene

Additional gene information for WNT1 Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for WNT1 Gene

Genomics for WNT1 Gene

GeneHancer (GH) Regulatory Elements for WNT1 Gene

Promoters and enhancers for WNT1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH12J048979 Promoter/Enhancer 1.5 EPDnew Ensembl ENCODE 750.6 +1.3 1280 3.4 CTCF RELA L3MBTL2 DACH1 NCOA6 CREM TRIM24 EGR1 KLF14 GMEB1 WNT1 ARF3 SPATS2 KMT2D FKBP11 LMBR1L KANSL2 DDX23 LOC390314 ENSG00000258017
GH12J048978 Enhancer 0.7 ENCODE 750.6 -0.6 -580 0.2 CTCF RELA L3MBTL2 MLLT1 TRIM24 GMEB1 IKZF1 BACH1 ZBTB33 IKZF2 WNT1 RF00026-234 RNU6-940P
GH12J048977 Enhancer 0.7 ENCODE 750.6 -1.0 -1030 0.1 SREBF1 MNT CBFA2T2 MYC EGR1 FOSL2 CREB1 CTBP1 RFX1 PKNOX1 RF00026-234 RNU6-940P WNT1
GH12J048932 Enhancer 0.6 Ensembl ENCODE 11.6 -44.4 -44413 3.4 CTCF PRDM10 RAD21 SMC3 WNT10B CCDC65 ARF3 RNU6-940P WNT1 FKBP11 RF00019-019 ENSG00000272822
GH12J048981 Enhancer 0.3 ENCODE 0.6 +3.2 3160 0.1 EZH2 NRF1 ARF3 FKBP11 WNT1 HSALNG0090906
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around WNT1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the WNT1 gene promoter:
  • E2F-1
  • E2F-2
  • HNF-4alpha1
  • HNF-4alpha2
  • PPAR-gamma1
  • PPAR-gamma2
  • SREBP-1a
  • SREBP-1b
  • SREBP-1c

Genomic Locations for WNT1 Gene

Genomic Locations for WNT1 Gene
chr12:48,978,453-48,982,613
(GRCh38/hg38)
Size:
4,161 bases
Orientation:
Plus strand
chr12:49,372,236-49,376,396
(GRCh37/hg19)
Size:
4,161 bases
Orientation:
Plus strand

Genomic View for WNT1 Gene

Genes around WNT1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
WNT1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for WNT1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for WNT1 Gene

Proteins for WNT1 Gene

  • Protein details for WNT1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P04628-WNT1_HUMAN
    Recommended name:
    Proto-oncogene Wnt-1
    Protein Accession:
    P04628
    Secondary Accessions:
    • Q5U0N2

    Protein attributes for WNT1 Gene

    Size:
    370 amino acids
    Molecular mass:
    40982 Da
    Quaternary structure:
    • Forms a soluble 1:1 complex with AFM; this prevents oligomerization and is required for prolonged biological activity (PubMed:26902720). The complex with AFM may represent the physiological form in body fluids (PubMed:26902720). Interacts with PORCN. Interacts with RSPO1, RSPO2 and RSPO3 (By similarity). Interacts with WLS (By similarity).

neXtProt entry for WNT1 Gene

Post-translational modifications for WNT1 Gene

  • Palmitoleoylation is required for efficient binding to frizzled receptors. Palmitoleoylation is necessary for proper trafficking to cell surface (Probable). Depalmitoleoylated by NOTUM, leading to inhibit Wnt signaling pathway (By similarity).
  • Glycosylation at Asn29, Asn316, Asn346, and Asn359
  • Modification sites at PhosphoSitePlus

Other Protein References for WNT1 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for WNT1 Gene

Domains & Families for WNT1 Gene

Gene Families for WNT1 Gene

HGNC:
Human Protein Atlas (HPA):
  • Cancer-related genes
  • Disease related genes
  • Predicted secreted proteins

Protein Domains for WNT1 Gene

Suggested Antigen Peptide Sequences for WNT1 Gene

GenScript: Design optimal peptide antigens:
  • INT1 protein (Q9BT91_HUMAN)
  • Proto-oncogene Int-1 homolog (WNT1_HUMAN)

Graphical View of Domain Structure for InterPro Entry

P04628

UniProtKB/Swiss-Prot:

WNT1_HUMAN :
  • Belongs to the Wnt family.
Family:
  • Belongs to the Wnt family.
genes like me logo Genes that share domains with WNT1: view

Function for WNT1 Gene

Molecular function for WNT1 Gene

UniProtKB/Swiss-Prot Function:
Ligand for members of the frizzled family of seven transmembrane receptors (Probable). Acts in the canonical Wnt signaling pathway by promoting beta-catenin-dependent transcriptional activation (PubMed:23499309, PubMed:26902720, PubMed:28528193, PubMed:23656646). In some developmental processes, is also a ligand for the coreceptor RYK, thus triggering Wnt signaling (By similarity). Plays an essential role in the development of the embryonic brain and central nervous system (CNS) (By similarity). Has a role in osteoblast function, bone development and bone homeostasis (PubMed:23499309, PubMed:23656646).
GENATLAS Biochemistry:
wingless-type MMTV integration site 1,Drosophila wingless (wg),segment polarity gene homolog,modulating cell fate and cell behavior during vertebrate development e

Phenotypes From GWAS Catalog for WNT1 Gene

Gene Ontology (GO) - Molecular Function for WNT1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005102 signaling receptor binding IEA --
GO:0005109 frizzled binding NAS 23461676
GO:0005125 cytokine activity ISS,IEA --
GO:0016015 morphogen activity TAS 24431302
GO:0019904 protein domain specific binding IEA --
genes like me logo Genes that share ontologies with WNT1: view
genes like me logo Genes that share phenotypes with WNT1: view

Human Phenotype Ontology for WNT1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for WNT1 Gene

MGI Knock Outs for WNT1:
  • Wnt1 Wnt1<tm1Brd>
  • Wnt1 Wnt1<tm1Mrc>
  • Wnt1 Wnt1<tm1Amc>
  • Wnt1 Wnt1<tm1b(EUCOMM)Wtsi>

Animal Model Products

CRISPR Products

Clone Products

  • Addgene plasmids for WNT1

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for WNT1 Gene

Localization for WNT1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for WNT1 Gene

Secreted, extracellular space, extracellular matrix. Secreted.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for WNT1 gene
Compartment Confidence
extracellular 5
plasma membrane 4
endoplasmic reticulum 4
golgi apparatus 4
cytoskeleton 2
nucleus 2
mitochondrion 1
cytosol 1
lysosome 0

Gene Ontology (GO) - Cellular Components for WNT1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region TAS,IEA --
GO:0005615 extracellular space IBA 21873635
GO:0005737 cytoplasm IDA 11793365
GO:0005788 endoplasmic reticulum lumen TAS --
GO:0005796 Golgi lumen TAS --
genes like me logo Genes that share ontologies with WNT1: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for WNT1 Gene

Pathways & Interactions for WNT1 Gene

genes like me logo Genes that share pathways with WNT1: view

Pathways by source for WNT1 Gene

1 Tocris pathway for WNT1 Gene
10 Qiagen pathways for WNT1 Gene
  • Colorectal Cancer Metastasis
  • G12-G13 in Cellular Signaling
  • GSK3 Signaling
  • Hedgehog Signaling in Mammals
  • Human Embryonic Stem Cell Pluripotency
2 GeneTex pathways for WNT1 Gene

SIGNOR curated interactions for WNT1 Gene

Activates:
Is activated by:
Is inactivated by:

Gene Ontology (GO) - Biological Process for WNT1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000578 embryonic axis specification ISS --
GO:0001658 branching involved in ureteric bud morphogenesis IEA --
GO:0001934 positive regulation of protein phosphorylation IEA --
GO:0007267 cell-cell signaling IEA,ISS --
GO:0007275 multicellular organism development IEA --
genes like me logo Genes that share ontologies with WNT1: view

Drugs & Compounds for WNT1 Gene

(4) Drugs for WNT1 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(6) Additional Compounds for WNT1 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with WNT1: view

Transcripts for WNT1 Gene

mRNA/cDNA for WNT1 Gene

(1) REFSEQ mRNAs :
(3) Additional mRNA sequences :
(3) Selected AceView cDNA sequences:
(2) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Clone Products

  • Addgene plasmids for WNT1

Alternative Splicing Database (ASD) splice patterns (SP) for WNT1 Gene

No ASD Table

Relevant External Links for WNT1 Gene

GeneLoc Exon Structure for
WNT1
ECgene alternative splicing isoforms for
WNT1

Expression for WNT1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for WNT1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for WNT1 Gene

This gene is overexpressed in Brain - Nucleus accumbens (basal ganglia) (x11.5), Brain - Putamen (basal ganglia) (x5.7), Brain - Cortex (x4.8), and Brain - Caudate (basal ganglia) (x4.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for WNT1 Gene



Protein tissue co-expression partners for WNT1 Gene

NURSA nuclear receptor signaling pathways regulating expression of WNT1 Gene:

WNT1

SOURCE GeneReport for Unigene cluster for WNT1 Gene:

Hs.248164

Evidence on tissue expression from TISSUES for WNT1 Gene

  • Nervous system(2.3)
  • Bone(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for WNT1 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • integumentary
  • nervous
  • reproductive
  • respiratory
  • skeletal muscle
  • skeleton
  • urinary
Regions:
Head and neck:
  • brain
  • cheek
  • chin
  • ear
  • eye
  • eyelid
  • face
  • forehead
  • head
  • jaw
  • larynx
  • lip
  • mandible
  • maxilla
  • middle ear
  • mouth
  • neck
  • nose
  • skull
  • tongue
  • tooth
  • vocal cord
Thorax:
  • chest wall
  • clavicle
  • heart
  • lung
  • rib
  • rib cage
  • scapula
  • sternum
Abdomen:
  • abdominal wall
  • biliary tract
  • intestine
  • kidney
  • liver
  • stomach
Pelvis:
  • pelvis
  • ureter
  • uterus
  • vagina
Limb:
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
General:
  • blood
  • blood vessel
  • skin
  • spinal column
  • spinal cord
  • vertebrae
genes like me logo Genes that share expression patterns with WNT1: view

No data available for Protein differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for WNT1 Gene

Orthologs for WNT1 Gene

This gene was present in the common ancestor of animals.

Orthologs for WNT1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia WNT1 33 32
  • 99.73 (n)
OneToOne
dog
(Canis familiaris)
Mammalia WNT1 33 32
  • 93.33 (n)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia WNT1 33
  • 93 (a)
OneToOne
cow
(Bos Taurus)
Mammalia WNT1 33 32
  • 92.97 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Wnt1 17 33 32
  • 91.53 (n)
rat
(Rattus norvegicus)
Mammalia Wnt1 32
  • 91.17 (n)
chicken
(Gallus gallus)
Aves WNT11B 33
  • 33 (a)
ManyToMany
lizard
(Anolis carolinensis)
Reptilia WNT1 33
  • 85 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100491444 32
  • 68.42 (n)
zebrafish
(Danio rerio)
Actinopterygii wnt1 33 32
  • 71.64 (n)
OneToOne
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP009734 32
  • 64.04 (n)
fruit fly
(Drosophila melanogaster)
Insecta wg 33 34 32
  • 62.08 (n)
OneToOne
Wnt5 34
  • 47 (a)
Wnt6 34
  • 44 (a)
worm
(Caenorhabditis elegans)
Secernentea cwn-1 33
  • 36 (a)
OneToMany
mom-2 34
  • 31 (a)
lin-44 34
  • 29 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 33
  • 29 (a)
ManyToMany
Species where no ortholog for WNT1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for WNT1 Gene

ENSEMBL:
Gene Tree for WNT1 (if available)
TreeFam:
Gene Tree for WNT1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for WNT1: view image

Paralogs for WNT1 Gene

(18) SIMAP similar genes for WNT1 Gene using alignment to 1 proteins:

  • WNT1_HUMAN
genes like me logo Genes that share paralogs with WNT1: view

Variants for WNT1 Gene

Polymorphic Variants from UniProtKB/Swiss-Prot for WNT1 Gene

WNT1_HUMAN-P04628
Genetic variations in WNT1 define the bone mineral density quantitative trait locus 16 (BMND16) [MIM:615221]. Variance in bone mineral density influences bone mass, contributes to size determination in the general population, and is a susceptibility factor for osteoporotic fractures.

Sequence variations from dbSNP and Humsavar for WNT1 Gene

SNP ID Clin Chr 12 pos Variation AA Info Type
rs1435433748 uncertain-significance, Osteogenesis imperfecta, type xv 48,981,617(+) C/G/T coding_sequence_variant, missense_variant
rs1555178899 likely-pathogenic, Osteogenesis imperfecta, type xv 48,978,757(+) AAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAGA/A intron_variant
rs1565722031 uncertain-significance, Osteogenesis imperfecta 48,981,516(+) G/A coding_sequence_variant, missense_variant
rs200151492 uncertain-significance, Osteogenesis imperfecta 48,981,281(+) G/A/C/T coding_sequence_variant, missense_variant
rs387907353 pathogenic, risk-factor, Osteogenesis imperfecta, type xv, Bone mineral density quantitative trait locus 16 48,981,381(+) CCCCCC/CCCCCCC coding_sequence_variant, frameshift

Structural Variations from Database of Genomic Variants (DGV) for WNT1 Gene

Variant ID Type Subtype PubMed ID
nsv558833 CNV loss 21841781
nsv832404 CNV gain 17160897

Variation tolerance for WNT1 Gene

Residual Variation Intolerance Score: 63.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.63; 31.27% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for WNT1 Gene

Human Gene Mutation Database (HGMD)
WNT1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
WNT1

SNP Genotyping and Copy Number Assay Products

Disorders for WNT1 Gene

MalaCards: The human disease database

(16) MalaCards diseases for WNT1 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search WNT1 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

WNT1_HUMAN
  • Osteoporosis (OSTEOP) [MIM:166710]: A systemic skeletal disorder characterized by decreased bone mass and deterioration of bone microarchitecture without alteration in the composition of bone. The result is fragile bones and an increased risk of fractures, even after minimal trauma. Osteoporosis is a chronic condition of multifactorial etiology and is usually clinically silent until a fracture occurs. {ECO:0000269 PubMed:23499309, ECO:0000269 PubMed:23656646}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.
  • Osteogenesis imperfecta 15 (OI15) [MIM:615220]: An autosomal recessive form of osteogenesis imperfecta, a connective tissue disorder characterized by low bone mass, bone fragility and susceptibility to fractures after minimal trauma. Disease severity ranges from very mild forms without fractures to intrauterine fractures and perinatal lethality. Extraskeletal manifestations, which affect a variable number of patients, are dentinogenesis imperfecta, hearing loss, and blue sclerae. OI15 is characterized by early-onset recurrent fractures, bone deformity, significant reduction of bone density, short stature, and, in some patients, blue sclerae. Tooth development and hearing are normal. Learning and developmental delays and brain anomalies have been observed in some patients. {ECO:0000269 PubMed:23434763, ECO:0000269 PubMed:23499309, ECO:0000269 PubMed:23499310, ECO:0000269 PubMed:23656646, ECO:0000269 PubMed:28528193}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for WNT1

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
Tumor Gene Database
(TGDB)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with WNT1: view

No data available for Genatlas for WNT1 Gene

Publications for WNT1 Gene

  1. The nucleotide sequence of the human int-1 mammary oncogene; evolutionary conservation of coding and non-coding sequences. (PMID: 2998762) van Ooyen A … Nusse R (The EMBO journal 1985) 2 3 4 56
  2. Novel missense loss-of-function mutations of WNT1 in an autosomal recessive Osteogenesis imperfecta patient. (PMID: 28528193) Won JY … Cho TJ (European journal of medical genetics 2017) 3 4 56
  3. Mutations in WNT1 are a cause of osteogenesis imperfecta. (PMID: 23434763) Fahiminiya S … Rauch F (Journal of medical genetics 2013) 3 4 56
  4. Mutations in WNT1 cause different forms of bone fragility. (PMID: 23499309) Keupp K … Wollnik B (American journal of human genetics 2013) 3 4 56
  5. WNT1 mutations in families affected by moderately severe and progressive recessive osteogenesis imperfecta. (PMID: 23499310) Pyott SM … Byers PH (American journal of human genetics 2013) 3 4 56

Products for WNT1 Gene

Sources for WNT1 Gene