Free for academic non-profit institutions. Other users need a Commercial license

Aliases for WNT10B Gene

Aliases for WNT10B Gene

  • Wnt Family Member 10B 2 3 5
  • Wingless-Type MMTV Integration Site Family, Member 10B 2 3
  • Protein Wnt-10b 3 4
  • WNT-10B Protein 3
  • Protein Wnt-12 4
  • STHAG8 3
  • WNT-12 3
  • SHFM6 3
  • WNT12 4

External Ids for WNT10B Gene

Previous GeneCards Identifiers for WNT10B Gene

  • GC12P049449
  • GC12P049527
  • GC12M049075
  • GC12M047645
  • GC12M049359
  • GC12M046390

Summaries for WNT10B Gene

Entrez Gene Summary for WNT10B Gene

  • The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It may be involved in breast cancer, and its protein signaling is likely a molecular switch that governs adipogenesis. This protein is 96% identical to the mouse Wnt10b protein at the amino acid level. This gene is clustered with another family member, WNT1, in the chromosome 12q13 region. [provided by RefSeq, Jul 2008]

GeneCards Summary for WNT10B Gene

WNT10B (Wnt Family Member 10B) is a Protein Coding gene. Diseases associated with WNT10B include Split-Hand/Foot Malformation 6 and Tooth Agenesis, Selective, 8. Among its related pathways are Developmental Biology and mTOR signaling pathway (KEGG). Gene Ontology (GO) annotations related to this gene include signaling receptor binding and receptor ligand activity. An important paralog of this gene is WNT10A.

UniProtKB/Swiss-Prot for WNT10B Gene

  • Member of the Wnt ligand gene family that encodes for secreted proteins, which activate the Wnt signaling cascade. Specifically activates canonical Wnt/beta-catenin signaling and thus triggers beta-catenin/LEF/TCF-mediated transcriptional programs. Involved in signaling networks controlling stemness, pluripotency and cell fate decisions. Acts in the immune system, mammary gland, adipose tissue, bone and skin.

Gene Wiki entry for WNT10B Gene

Additional gene information for WNT10B Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for WNT10B Gene

Genomics for WNT10B Gene

GeneHancer (GH) Regulatory Elements for WNT10B Gene

Promoters and enhancers for WNT10B Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH12J048971 Promoter/Enhancer 1.8 EPDnew Ensembl ENCODE 1000.6 +0.2 157 0.6 SP7 KLF14 ZBTB8A PRDM10 ZSCAN4 ZNF639 ZNF341 PATZ1 KLF7 HDAC1 WNT10B FKBP11 GC12P048969
GH12J048970 Promoter/Enhancer 1.2 Ensembl ENCODE 1000.6 +1.9 1904 0.7 ZNF687 ZBTB33 BACH1 ZEB2 EZH2 MBD1 RNF2 RUNX3 IKZF1 TFDP1 GC12P048969 WNT10B FKBP11
GH12J048955 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 10.5 +15.3 15257 4 ELF3 MLLT1 POLR2A ZNF148 ELF1 TRIM24 ZBTB7A SP7 KLF14 ZNF548 ARF3 ENSG00000272822 CCNT1 KANSL2 LMBR1L LOC390314 DDX23 KMT2D SENP1 PRPF40B
GH12J048979 Promoter/Enhancer 1.8 EPDnew Ensembl ENCODE 7.3 -7.8 -7762 3.2 TRIM24 NCOA6 RELA KLF14 CREM EGR1 IKZF1 GLIS2 GMEB1 IKZF2 WNT1 ARF3 FKBP11 ENSG00000255863 WNT10B GC12P049026
GH12J048903 Promoter/Enhancer 1.9 EPDnew Ensembl ENCODE 6.9 +67.8 67829 1.9 CTCF ZNF652 CEBPG MLLT1 KLF14 MZF1 ZNF680 ZNF404 ZBTB8A PRDM10 CCDC65 RPL32P27 DDX23 KMT2D LMBR1L BCDIN3D SENP1 LOC390314 CCNT1 KANSL2
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around WNT10B on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the WNT10B gene promoter:
  • E2F
  • E2F-1
  • E2F-2
  • HNF-4alpha1
  • HNF-4alpha2
  • PPAR-gamma1
  • PPAR-gamma2
  • SREBP-1a
  • SREBP-1b
  • SREBP-1c

Genomic Locations for WNT10B Gene

Genomic Locations for WNT10B Gene
6,519 bases
Minus strand
6,519 bases
Minus strand

Genomic View for WNT10B Gene

Genes around WNT10B on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
WNT10B Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for WNT10B Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for WNT10B Gene

Proteins for WNT10B Gene

  • Protein details for WNT10B Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein Wnt-10b
    Protein Accession:
    Secondary Accessions:
    • B2R7A5
    • O00747
    • Q4VAJ4
    • Q4VAJ5
    • Q8WZ97

    Protein attributes for WNT10B Gene

    389 amino acids
    Molecular mass:
    43000 Da
    Quaternary structure:
    • Forms a soluble 1:1 complex with AFM; this prevents oligomerization and is required for prolonged biological activity (PubMed:26902720). The complex with AFM may represent the physiological form in body fluids (PubMed:26902720).

    Alternative splice isoforms for WNT10B Gene


neXtProt entry for WNT10B Gene

Post-translational modifications for WNT10B Gene

  • Palmitoleoylation is required for efficient binding to frizzled receptors. Depalmitoleoylation leads to Wnt signaling pathway inhibition.
  • Glycosylation at posLast=335335 and Asn93
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for WNT10B Gene

Domains & Families for WNT10B Gene

Gene Families for WNT10B Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted secreted proteins

Protein Domains for WNT10B Gene

Suggested Antigen Peptide Sequences for WNT10B Gene

GenScript: Design optimal peptide antigens:
  • Protein Wnt (B5MCC8_HUMAN)
  • Protein Wnt (C9J3H3_HUMAN)
  • Protein Wnt (C9JCI2_HUMAN)
  • Protein Wnt (Q4VAJ4_HUMAN)
  • Protein Wnt-12 (WN10B_HUMAN)

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the Wnt family.
  • Belongs to the Wnt family.
genes like me logo Genes that share domains with WNT10B: view

Function for WNT10B Gene

Molecular function for WNT10B Gene

UniProtKB/Swiss-Prot Function:
Member of the Wnt ligand gene family that encodes for secreted proteins, which activate the Wnt signaling cascade. Specifically activates canonical Wnt/beta-catenin signaling and thus triggers beta-catenin/LEF/TCF-mediated transcriptional programs. Involved in signaling networks controlling stemness, pluripotency and cell fate decisions. Acts in the immune system, mammary gland, adipose tissue, bone and skin.
GENATLAS Biochemistry:
wingless-type MMTV integration site 10B,Drosophila wingless (Wg) segment polarity gene homolog,expressed in breast carcinoma,heart,skeletal muscle,modulating cell fate and cell behavior during vertebrate development

Phenotypes From GWAS Catalog for WNT10B Gene

Gene Ontology (GO) - Molecular Function for WNT10B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005102 signaling receptor binding IEA --
GO:0005109 frizzled binding IBA 21873635
GO:0048018 receptor ligand activity IC 17761539
genes like me logo Genes that share ontologies with WNT10B: view
genes like me logo Genes that share phenotypes with WNT10B: view

Human Phenotype Ontology for WNT10B Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for WNT10B Gene

MGI Knock Outs for WNT10B:

Animal Model Products

  • Taconic Biosciences Mouse Models for WNT10B

CRISPR Products

Clone Products

  • Applied Biological Materials (abm): Clones for WNT10B - Now 50% OFF >
  • * WNT10B as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * WNT10B tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for WNT10B Gene

Localization for WNT10B Gene

Subcellular locations from UniProtKB/Swiss-Prot for WNT10B Gene

Secreted, extracellular space, extracellular matrix. Secreted.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for WNT10B gene
Compartment Confidence
extracellular 5
nucleus 2
cytosol 2
plasma membrane 1
cytoskeleton 1
peroxisome 1
endoplasmic reticulum 1
lysosome 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Golgi apparatus (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for WNT10B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region TAS,IEA --
GO:0005615 extracellular space NAS,IBA 15135146
genes like me logo Genes that share ontologies with WNT10B: view

Pathways & Interactions for WNT10B Gene

genes like me logo Genes that share pathways with WNT10B: view

SIGNOR curated interactions for WNT10B Gene

Is inactivated by:

Gene Ontology (GO) - Biological Process for WNT10B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000086 G2/M transition of mitotic cell cycle IEA --
GO:0000122 negative regulation of transcription by RNA polymerase II IEA --
GO:0002062 chondrocyte differentiation IEP 15135146
GO:0006357 regulation of transcription by RNA polymerase II IEA --
GO:0006629 lipid metabolic process IEA --
genes like me logo Genes that share ontologies with WNT10B: view

Drugs & Compounds for WNT10B Gene

(10) Drugs for WNT10B Gene - From: ApexBio and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
FH535 Pharma Inhibitor of Wnt/beta-catenin signaling, Wnt/B-catenin inhibitor 0
ICG 001 Pharma Wnt/β-catenin pathway inhibitor 0
IWP 2 Pharma PORCN inhibitor; inhibits Wnt processing and secretion, Wnt production inhibitor,PORCN inhibitor 0
IWR-1-endo Pharma Potent Wnt signaling inhibitor 0
Kartogenin Pharma 0

(1) Additional Compounds for WNT10B Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs

(9) ApexBio Compounds for WNT10B Gene

Compound Action Cas Number
FH535 Wnt/B-catenin inhibitor 108409-83-2
ICG 001 Wnt/β-catenin pathway inhibitor 847591-62-2
IWP-2 Wnt production inhibitor,PORCN inhibitor 686770-61-6
IWR-1-endo Potent Wnt signaling inhibitor 1127442-82-3
Kartogenin 4727-31-5
KY 02111 WNT signaling inhibitor 1118807-13-8
LGK-974 PORCN inhibitor,potent and specific 1243244-14-5
Salinomycin Polyether ionophore antibiotic;anti-cancer 53003-10-4
Wnt-C59 PORCN inhibitor,highly potent and selective 1243243-89-1
genes like me logo Genes that share compounds with WNT10B: view

Drug Products

Transcripts for WNT10B Gene

mRNA/cDNA for WNT10B Gene

(1) REFSEQ mRNAs :
(9) Additional mRNA sequences :
(4) Selected AceView cDNA sequences:
(6) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

Unigene Clusters for WNT10B Gene

Wingless-type MMTV integration site family, member 10B:
Representative Sequences:

CRISPR Products

Clone Products

  • Applied Biological Materials (abm): Clones for WNT10B - Now 50% OFF >
  • * WNT10B as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * WNT10B tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

Alternative Splicing Database (ASD) splice patterns (SP) for WNT10B Gene

No ASD Table

Relevant External Links for WNT10B Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for WNT10B Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for WNT10B Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for WNT10B Gene

This gene is overexpressed in Brain - Nucleus accumbens (basal ganglia) (x6.9), Brain - Cortex (x6.2), Brain - Anterior cingulate cortex (BA24) (x5.0), Brain - Putamen (basal ganglia) (x4.9), Brain - Frontal Cortex (BA9) (x4.9), Brain - Caudate (basal ganglia) (x4.1), and Brain - Amygdala (x4.0).

Protein differential expression in normal tissues from HIPED for WNT10B Gene

This gene is overexpressed in Cervix (45.1), Plasma (14.0), and Heart (6.4).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for WNT10B Gene

Protein tissue co-expression partners for WNT10B Gene

NURSA nuclear receptor signaling pathways regulating expression of WNT10B Gene:


SOURCE GeneReport for Unigene cluster for WNT10B Gene:


mRNA Expression by UniProt/SwissProt for WNT10B Gene:

Tissue specificity: Detected in most adult tissues. Highest levels were found in heart and skeletal muscle. Low levels are found in brain.

Evidence on tissue expression from TISSUES for WNT10B Gene

  • Nervous system(4.5)
  • Skin(2.2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for WNT10B Gene

Germ Layers:
  • ectoderm
  • mesoderm
  • cardiovascular
  • digestive
  • immune
  • integumentary
  • nervous
  • reproductive
  • skeletal muscle
  • skeleton
  • urinary
Head and neck:
  • brain
  • chin
  • cranial nerve
  • ear
  • eye
  • face
  • head
  • jaw
  • lip
  • mandible
  • maxilla
  • middle ear
  • mouth
  • outer ear
  • skull
  • kidney
  • testicle
  • ureter
  • urinary bladder
  • ankle
  • arm
  • digit
  • finger
  • foot
  • forearm
  • hand
  • lower limb
  • nail
  • toe
  • upper limb
  • wrist
  • blood
  • blood vessel
  • coagulation system
  • peripheral nervous system
  • skin
genes like me logo Genes that share expression patterns with WNT10B: view

Orthologs for WNT10B Gene

This gene was present in the common ancestor of animals.

Orthologs for WNT10B Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia WNT10B 35 34
  • 99.06 (n)
(Canis familiaris)
Mammalia WNT10B 34
  • 93.21 (n)
(Bos Taurus)
Mammalia WNT10B 35 34
  • 91.92 (n)
(Rattus norvegicus)
Mammalia Wnt10b 34
  • 90.44 (n)
(Mus musculus)
Mammalia Wnt10b 17 35 34
  • 90.16 (n)
(Ornithorhynchus anatinus)
Mammalia -- 35
  • 20 (a)
(Gallus gallus)
Aves -- 35
  • 34 (a)
(Anolis carolinensis)
Reptilia WNT10B 35
  • 60 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia wnt10b 34
  • 66.67 (n)
African clawed frog
(Xenopus laevis)
Amphibia wnt10-A 34
(Danio rerio)
Actinopterygii wnt10b 35 34 34
  • 66.39 (n)
fruit fly
(Drosophila melanogaster)
Insecta Wnt10 35 36 34
  • 54.14 (n)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP009731 34
  • 45.97 (n)
(Caenorhabditis elegans)
Secernentea mom-2 35
  • 30 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 39 (a)
Species where no ortholog for WNT10B was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for WNT10B Gene

Gene Tree for WNT10B (if available)
Gene Tree for WNT10B (if available)
Evolutionary constrained regions (ECRs) for WNT10B: view image

Paralogs for WNT10B Gene

(13) SIMAP similar genes for WNT10B Gene using alignment to 5 proteins:

  • C9J3H3_HUMAN
genes like me logo Genes that share paralogs with WNT10B: view

Variants for WNT10B Gene

Sequence variations from dbSNP and Humsavar for WNT10B Gene

SNP ID Clin Chr 12 pos Variation AA Info Type
rs1163162816 likely-pathogenic, Split-hand/foot malformation 6 48,968,320(-) C/G/T splice_acceptor_variant
rs121918349 pathogenic, Split-hand/foot malformation 6, Split-hand/foot malformation 6 (SHFM6) [MIM:225300] 48,966,271(-) G/A/C/T 3_prime_UTR_variant, coding_sequence_variant, missense_variant, synonymous_variant
rs1555178899 likely-pathogenic, Osteogenesis imperfecta, type xv 48,978,757(-) AAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAGA/A genic_upstream_transcript_variant, intron_variant
rs387907353 pathogenic, risk-factor, Osteogenesis imperfecta, type xv, Bone mineral density quantitative trait locus 16 48,981,381(-) CCCCCC/CCCCCCC upstream_transcript_variant
rs387907354 pathogenic, Osteogenesis imperfecta, type xv 48,980,693(-) A/G upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for WNT10B Gene

Variant ID Type Subtype PubMed ID
nsv558833 CNV loss 21841781
nsv832404 CNV gain 17160897

Variation tolerance for WNT10B Gene

Residual Variation Intolerance Score: 33.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.49; 29.05% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for WNT10B Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for WNT10B Gene

Disorders for WNT10B Gene

MalaCards: The human disease database

(11) MalaCards diseases for WNT10B Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
split-hand/foot malformation 6
  • shfm6
tooth agenesis, selective, 8
  • sthag8
isolated split hand-split foot malformation
  • ectrodactyly
tooth agenesis
  • familial tooth agenesis
split hand-foot malformation
  • split-hand deformity
- elite association - COSMIC cancer census association via MalaCards


  • Split-hand/foot malformation 6 (SHFM6) [MIM:225300]: A limb malformation involving the central rays of the autopod and presenting with syndactyly, median clefts of the hands and feet, and aplasia and/or hypoplasia of the phalanges, metacarpals, and metatarsals. Some patients have been found to have mental retardation, ectodermal and craniofacial findings, and orofacial clefting. {ECO:0000269 PubMed:18515319}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Tooth agenesis, selective, 8 (STHAG8) [MIM:617073]: A form of selective tooth agenesis, a common anomaly characterized by the congenital absence of one or more teeth. Selective tooth agenesis without associated systemic disorders has sometimes been divided into 2 types: oligodontia, defined as agenesis of 6 or more permanent teeth, and hypodontia, defined as agenesis of less than 6 teeth. The number in both cases does not include absence of third molars (wisdom teeth). STHAG8 inheritance is autosomal dominant. {ECO:0000269 PubMed:27321946}. Note=The disease is caused by mutations affecting the gene represented in this entry. Potential genotype-phenotype correlation between variants and the positions of missing teeth. {ECO:0000269 PubMed:27321946}.

Additional Disease Information for WNT10B

Genetic Association Database
Human Genome Epidemiology Navigator
Tumor Gene Database
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with WNT10B: view

No data available for Genatlas for WNT10B Gene

Publications for WNT10B Gene

  1. A novel human Wnt gene, WNT10B, maps to 12q13 and is expressed in human breast carcinomas. (PMID: 9121776) Bui TD … Lindsay S (Oncogene 1997) 2 3 4 23 58
  2. Homozygous WNT10b mutation and complex inheritance in Split-Hand/Foot Malformation. (PMID: 18515319) Ugur SA … Tolun A (Human molecular genetics 2008) 2 3 4 58
  3. Proto-oncogene WNT10B is up-regulated by tumor necrosis factor alpha in human gastric cancer cell line MKN45. (PMID: 11713588) Saitoh T … Katoh M (International journal of oncology 2001) 3 4 23 58
  4. Isolation, characterization and chromosomal localization of human WNT10B. (PMID: 9284937) Hardiman G … Bazan JF (Cytogenetics and cell genetics 1997) 2 3 4 58
  5. Mutations in WNT10B Are Identified in Individuals with Oligodontia. (PMID: 27321946) Yu P … Cai T (American journal of human genetics 2016) 3 4 58

Products for WNT10B Gene

Sources for WNT10B Gene

Loading form....