Free for academic non-profit institutions. Other users need a Commercial license

Aliases for USF3 Gene

Aliases for USF3 Gene

  • Upstream Transcription Factor Family Member 3 2 3 5
  • KIAA2018 2 3 4
  • Basic Helix-Loop-Helix Domain-Containing Protein USF3 3
  • Upstream Transcription Factor 3 4

External Ids for USF3 Gene

Previous HGNC Symbols for USF3 Gene

  • KIAA2018

Summaries for USF3 Gene

Entrez Gene Summary for USF3 Gene

  • This gene encodes a large protein that contains a helix-loop-helix domain and a polyglutamine region. A deletion in the polyglutamine region was associated with risk for thyroid carcinoma. [provided by RefSeq, May 2017]

GeneCards Summary for USF3 Gene

USF3 (Upstream Transcription Factor Family Member 3) is a Protein Coding gene.

UniProtKB/Swiss-Prot for USF3 Gene

  • Involved in the negative regulation of epithelial-mesenchymal transition, the process by which epithelial cells lose their polarity and adhesion properties to become mesenchymal cells with enhanced migration and invasive properties.

Additional gene information for USF3 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for USF3 Gene

Genomics for USF3 Gene

GeneHancer (GH) Regulatory Elements for USF3 Gene

Promoters and enhancers for USF3 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH03I113694 Promoter/Enhancer 2.3 EPDnew FANTOM5 Ensembl ENCODE 560.5 -0.5 -527 4.8 HDGF PKNOX1 ARID4B NEUROD1 SIN3A DMAP1 YBX1 ZBTB7B YY1 E2F8 USF3 NAA50 GTPBP8 NEPRO QTRT2 SIDT1 ATP6V1A GC03P113719
GH03I112990 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 13.9 +705.1 705117 2.6 HDGF SMAD1 ARID4B SIN3A DMAP1 ZNF2 YY1 POLR2B ZNF766 ZNF207 GTPBP8 ENSG00000272844 NEPRO USF3 SPICE1 CFAP44 CD200R1 PIR55468
GH03I113742 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 10.3 -49.7 -49650 8.5 HDGF PKNOX1 SMAD1 ARID4B SIN3A DMAP1 ZNF2 YY1 SLC30A9 ZNF766 ATP6V1A NAA50 ENSG00000242659 SPICE1 QTRT2 NEPRO LOC101180897 CFAP44 BOC USF3
GH03I113513 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 10.4 +181.6 181614 2.3 ATF1 ARID4B SIN3A ZNF2 ZNF48 YY1 POLR2B E2F8 ELK1 ATF7 SPICE1 LOC101180897 CFAP44 NEPRO SIDT1-AS1 USF3 GC03P113463
GH03I114446 Promoter/Enhancer 1.7 Ensembl ENCODE dbSUPER 10.6 -755.2 -755241 11.3 PKNOX1 BMI1 BATF IRF4 ZNF335 ZNF23 ZNF366 ETV6 BCLAF1 IKZF2 SPICE1 QTRT2 ENSG00000259976 USF3 ZBTB20-AS5 GC03P114568 ZBTB20
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around USF3 on UCSC Golden Path with GeneCards custom track

Genomic Locations for USF3 Gene

Genomic Locations for USF3 Gene
chr3:113,648,385-113,696,646
(GRCh38/hg38)
Size:
48,262 bases
Orientation:
Minus strand
chr3:113,367,232-113,415,493
(GRCh37/hg19)

Genomic View for USF3 Gene

Genes around USF3 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
USF3 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for USF3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for USF3 Gene

Proteins for USF3 Gene

  • Protein details for USF3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q68DE3-USF3_HUMAN
    Recommended name:
    Basic helix-loop-helix domain-containing protein USF3
    Protein Accession:
    Q68DE3
    Secondary Accessions:
    • Q7Z3L9
    • Q8IVF3
    • Q9H8T4

    Protein attributes for USF3 Gene

    Size:
    2245 amino acids
    Molecular mass:
    241681 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=BAB14518.1; Type=Miscellaneous discrepancy; Note=Chimeric cDNA.; Evidence={ECO:0000305}; Sequence=CAH18277.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305};

neXtProt entry for USF3 Gene

Post-translational modifications for USF3 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for USF3 Gene

No data available for DME Specific Peptides for USF3 Gene

Domains & Families for USF3 Gene

Gene Families for USF3 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for USF3 Gene

Suggested Antigen Peptide Sequences for USF3 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with USF3: view

No data available for UniProtKB/Swiss-Prot for USF3 Gene

Function for USF3 Gene

Molecular function for USF3 Gene

UniProtKB/Swiss-Prot Function:
Involved in the negative regulation of epithelial-mesenchymal transition, the process by which epithelial cells lose their polarity and adhesion properties to become mesenchymal cells with enhanced migration and invasive properties.

Phenotypes From GWAS Catalog for USF3 Gene

Gene Ontology (GO) - Molecular Function for USF3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003677 DNA binding IEA --
GO:0004571 mannosyl-oligosaccharide 1,2-alpha-mannosidase activity IBA --
GO:0046983 protein dimerization activity IEA --
genes like me logo Genes that share ontologies with USF3: view

Phenotypes for USF3 Gene

MGI mutant phenotypes for USF3:
inferred from 1 alleles
GenomeRNAi human phenotypes for USF3:
genes like me logo Genes that share phenotypes with USF3: view

Animal Models for USF3 Gene

MGI Knock Outs for USF3:
  • Usf3 tm2b(EUCOMM)Wtsi

Animal Model Products

miRNA for USF3 Gene

miRTarBase miRNAs that target USF3

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for USF3 Gene

Localization for USF3 Gene

Subcellular locations from UniProtKB/Swiss-Prot for USF3 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for USF3 gene
Compartment Confidence
nucleus 5
endoplasmic reticulum 3
cytosol 3
golgi apparatus 3
cytoskeleton 2

Subcellular locations from the

Human Protein Atlas (HPA)
  • Centrosome (1)
  • Nucleoli (1)
  • Nucleoplasm (1)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for USF3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000139 Golgi membrane IBA --
GO:0005634 nucleus IEA --
GO:0005783 endoplasmic reticulum IBA --
genes like me logo Genes that share ontologies with USF3: view

Pathways & Interactions for USF3 Gene

No Data Available

Interacting Proteins for USF3 Gene

Selected Interacting proteins: Q68DE3-USF3_HUMAN for USF3 Gene via IID

Symbol External ID(s) Details
NFYC

Gene Ontology (GO) - Biological Process for USF3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006491 N-glycan processing IBA --
GO:0010719 negative regulation of epithelial to mesenchymal transition IMP 28011713
genes like me logo Genes that share ontologies with USF3: view

No data available for Pathways by source and SIGNOR curated interactions for USF3 Gene

Drugs & Compounds for USF3 Gene

No Compound Related Data Available

Transcripts for USF3 Gene

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for USF3 Gene

No ASD Table

Relevant External Links for USF3 Gene

GeneLoc Exon Structure for
USF3
ECgene alternative splicing isoforms for
USF3

Expression for USF3 Gene

NURSA nuclear receptor signaling pathways regulating expression of USF3 Gene:

USF3

Evidence on tissue expression from TISSUES for USF3 Gene

  • Nervous system(4.3)
  • Eye(4)
No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for USF3 Gene

Orthologs for USF3 Gene

This gene was present in the common ancestor of chordates.

Orthologs for USF3 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia KIAA2018 34 33
  • 99.44 (n)
OneToOne
dog
(Canis familiaris)
Mammalia KIAA2018 34 33
  • 90.16 (n)
OneToOne
cow
(Bos Taurus)
Mammalia KIAA2018 34 33
  • 89.14 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Gm608 33 34
  • 85.82 (n)
Usf3 16
rat
(Rattus norvegicus)
Mammalia RGD1560175 33
  • 85.14 (n)
oppossum
(Monodelphis domestica)
Mammalia KIAA2018 34
  • 79 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia KIAA2018 34
  • 59 (a)
OneToOne
chicken
(Gallus gallus)
Aves KIAA2018 34 33
  • 71.89 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia KIAA2018 34
  • 58 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100145754 33
  • 59.73 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.33642 33
zebrafish
(Danio rerio)
Actinopterygii si:ch73-196k8.2 34
  • 31 (a)
OneToOne
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 23 (a)
OneToOne
Species where no ortholog for USF3 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for USF3 Gene

ENSEMBL:
Gene Tree for USF3 (if available)
TreeFam:
Gene Tree for USF3 (if available)

Paralogs for USF3 Gene

No data available for Paralogs for USF3 Gene

Variants for USF3 Gene

Sequence variations from dbSNP and Humsavar for USF3 Gene

SNP ID Clin Chr 03 pos Variation AA Info Type
rs10606566 likely-benign, not specified 113,657,264(-) TGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT/TGCTGCTGCTGCTGCTGCTGCTGCT/TGCTGCTGCTGCTGCTGCTGCTGCTGCT/TGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT/TGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT/TGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT/TGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT/TGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT coding_sequence_variant, inframe_deletion, inframe_insertion, intron_variant
rs1000001993 -- 113,652,044(-) T/C 3_prime_UTR_variant, intron_variant
rs1000089700 -- 113,673,651(-) A/G intron_variant
rs1000247099 -- 113,668,201(-) G/A intron_variant
rs1000263389 -- 113,692,222(-) C/T intron_variant

Structural Variations from Database of Genomic Variants (DGV) for USF3 Gene

Variant ID Type Subtype PubMed ID
nsv1013506 CNV gain 25217958
nsv819838 CNV loss 19587683

Variation tolerance for USF3 Gene

Residual Variation Intolerance Score: 4.25% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 8.22; 84.95% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for USF3 Gene

Human Gene Mutation Database (HGMD)
USF3
SNPedia medical, phenotypic, and genealogical associations of SNPs for
USF3

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for USF3 Gene

Disorders for USF3 Gene

No disorders were found for USF3 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for USF3 Gene

Publications for USF3 Gene

  1. Germline compound heterozygous poly-glutamine deletion in USF3 may be involved in predisposition to heritable and sporadic epithelial thyroid carcinoma. (PMID: 28011713) Ni Y … Eng C (Human molecular genetics 2017) 3 4 58
  2. Identification of 23 new prostate cancer susceptibility loci using the iCOGS custom genotyping array. (PMID: 23535732) Eeles RA … Easton DF (Nature genetics 2013) 3 58
  3. Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (PMID: 22504420) Estrada K … Rivadeneira F (Nature genetics 2012) 3 58
  4. A human MAP kinase interactome. (PMID: 20936779) Bandyopadhyay S … Ideker T (Nature methods 2010) 3 58
  5. A quantitative atlas of mitotic phosphorylation. (PMID: 18669648) Dephoure N … Gygi SP (Proceedings of the National Academy of Sciences of the United States of America 2008) 4 58

Products for USF3 Gene

Sources for USF3 Gene

Content
Loading form....