Free for academic non-profit institutions. Other users need a Commercial license

Aliases for UHRF1 Gene

Aliases for UHRF1 Gene

  • Ubiquitin Like With PHD And Ring Finger Domains 1 2 3 5
  • Ubiquitin-Like PHD And RING Finger Domain-Containing Protein 1 3 4
  • Inverted CCAAT Box-Binding Protein Of 90 KDa 3 4
  • RING-Type E3 Ubiquitin Transferase UHRF1 3 4
  • E3 Ubiquitin-Protein Ligase UHRF1 3 4
  • Nuclear Zinc Finger Protein Np95 3 4
  • Transcription Factor ICBP90 3 4
  • RING Finger Protein 106 3 4
  • Nuclear Protein 95 3 4
  • HuNp95 3 4
  • ICBP90 3 4
  • RNF106 3 4
  • HUHRF1 3 4
  • Ubiquitin-Like-Containing PHD And RING Finger Domains Protein 1 4
  • Nuclear Phosphoprotein 95 3
  • EC 2.3.2.27 4
  • EC 6.3.2 56
  • TDRD22 3
  • HNP95 3
  • HNp95 4
  • Np95 3
  • NP95 4

External Ids for UHRF1 Gene

Previous GeneCards Identifiers for UHRF1 Gene

  • GC19P005001
  • GC19P004849
  • GC19P004860
  • GC19P004861
  • GC19P004671

Summaries for UHRF1 Gene

Entrez Gene Summary for UHRF1 Gene

  • This gene encodes a member of a subfamily of RING-finger type E3 ubiquitin ligases. The protein binds to specific DNA sequences, and recruits a histone deacetylase to regulate gene expression. Its expression peaks at late G1 phase and continues during G2 and M phases of the cell cycle. It plays a major role in the G1/S transition by regulating topoisomerase IIalpha and retinoblastoma gene expression, and functions in the p53-dependent DNA damage checkpoint. It is regarded as a hub protein for the integration of epigenetic information. This gene is up-regulated in various cancers, and it is therefore considered to be a therapeutic target. Multiple transcript variants encoding different isoforms have been found for this gene. A related pseudogene exists on chromosome 12. [provided by RefSeq, Feb 2014]

GeneCards Summary for UHRF1 Gene

UHRF1 (Ubiquitin Like With PHD And Ring Finger Domains 1) is a Protein Coding gene. Diseases associated with UHRF1 include Colorectal Cancer and Cerebellar Ataxia, Deafness, And Narcolepsy, Autosomal Dominant. Among its related pathways are Chromatin Regulation / Acetylation and Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3. Gene Ontology (GO) annotations related to this gene include DNA-binding transcription factor activity and ligase activity. An important paralog of this gene is UHRF2.

UniProtKB/Swiss-Prot for UHRF1 Gene

  • Multidomain protein that acts as a key epigenetic regulator by bridging DNA methylation and chromatin modification. Specifically recognizes and binds hemimethylated DNA at replication forks via its YDG domain and recruits DNMT1 methyltransferase to ensure faithful propagation of the DNA methylation patterns through DNA replication. In addition to its role in maintenance of DNA methylation, also plays a key role in chromatin modification: through its tudor-like regions and PHD-type zinc fingers, specifically recognizes and binds histone H3 trimethylated at 'Lys-9' (H3K9me3) and unmethylated at 'Arg-2' (H3R2me0), respectively, and recruits chromatin proteins. Enriched in pericentric heterochromatin where it recruits different chromatin modifiers required for this chromatin replication. Also localizes to euchromatic regions where it negatively regulates transcription possibly by impacting DNA methylation and histone modifications. Has E3 ubiquitin-protein ligase activity by mediating the ubiquitination of target proteins such as histone H3 and PML. It is still unclear how E3 ubiquitin-protein ligase activity is related to its role in chromatin in vivo. May be involved in DNA repair.

Gene Wiki entry for UHRF1 Gene

Additional gene information for UHRF1 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for UHRF1 Gene

Genomics for UHRF1 Gene

GeneHancer (GH) Regulatory Elements for UHRF1 Gene

Promoters and enhancers for UHRF1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH19J004907 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 605.7 +9.6 9603 9.5 SP1 CC2D1A CTCF ZNF148 NKRF ZNF121 POLR2A ZNF687 FOS AHR UHRF1 SAFB2 PLIN3 SAFB ENSG00000267769 YJU2 ENSG00000267030 PTPRS ARRDC5
GH19J004904 Enhancer 0.7 Ensembl 600.7 +1.6 1621 0.2 ZNF24 SP1 ZNF644 GATAD2A RXRB RCOR2 SOX13 ZKSCAN8 SAP130 TEAD1 UHRF1 ARRDC5
GH19J004900 Enhancer 0.6 Ensembl 600.7 -1.4 -1379 4.2 ZNF121 ZNF600 ATF7 ZNF629 BCOR ZNF26 BHLHE40 ZNF664 ATF2 ZNF3 UHRF1 DUS3L YJU2 SNRPEP4 ENSG00000267030 ARRDC5 SIRT6 GC19M004863
GH19J004974 Promoter/Enhancer 1.9 FANTOM5 Ensembl ENCODE dbSUPER 6.3 +74.1 74092 5.3 HDGF ELF3 CEBPG ZNF384 AHR NCOA3 SP7 SP1 KAT8 CREB1 KDM4B UHRF1 TICAM1 PIR49056 GC19M004987
GH19J005125 Enhancer 1.3 FANTOM5 ENCODE dbSUPER 5.6 +226.2 226157 8 SP1 ZKSCAN8 CBFA2T2 ZNF148 ZNF687 ZBTB7A CREM MLLT1 EGR1 IKZF1 UHRF1 SAFB2 GC19P005127 PIR36975 KDM4B
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around UHRF1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the UHRF1 gene promoter:
  • AML1a
  • Egr-3
  • MZF-1
  • PPAR-gamma1
  • PPAR-gamma2

Genomic Locations for UHRF1 Gene

Genomic Locations for UHRF1 Gene
chr19:4,903,080-4,962,154
(GRCh38/hg38)
Size:
59,075 bases
Orientation:
Plus strand
chr19:4,903,092-4,962,165
(GRCh37/hg19)
Size:
59,074 bases
Orientation:
Plus strand

Genomic View for UHRF1 Gene

Genes around UHRF1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
UHRF1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for UHRF1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for UHRF1 Gene

Proteins for UHRF1 Gene

  • Protein details for UHRF1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q96T88-UHRF1_HUMAN
    Recommended name:
    E3 ubiquitin-protein ligase UHRF1
    Protein Accession:
    Q96T88
    Secondary Accessions:
    • A0JBR2
    • A8K024
    • B2RBA9
    • Q2HIX7
    • Q8J022
    • Q9H6S6
    • Q9P115
    • Q9P1U7

    Protein attributes for UHRF1 Gene

    Size:
    793 amino acids
    Molecular mass:
    89814 Da
    Quaternary structure:
    • Interacts with DNMT3A and DNMT3B (By similarity). Interacts with DNMT1; the interaction is direct. Interacts with USP7; leading to its deubiquitination. Interacts with histone H3. Interacts with HDAC1, but not with HDAC2. Interacts with UHRF1BP1. Interacts with PML. Interacts with EHMT2. Binds hemimethylated CpG containing oligonucleotides.
    SequenceCaution:
    • Sequence=BAB15177.1; Type=Erroneous initiation; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for UHRF1 Gene

    Alternative splice isoforms for UHRF1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for UHRF1 Gene

Selected DME Specific Peptides for UHRF1 Gene

Q96T88:
  • HNVCKDCL
  • EGNRYDGIYKVVKYWPE
  • VWRYLLRRDD
  • GIHGRSNDGAYSLVLAGG
  • GVHRPHV
  • QRLFYRGKQ
  • WRFRVQVSE
  • AQVFSCPACR

Post-translational modifications for UHRF1 Gene

  • Phosphorylation at Ser-298 of the linker region decreases the binding to H3K9me3. Phosphorylation at Ser-639 by CDK1 during M phase impairs interaction with USP7, preventing deubiquitination and leading to degradation by the proteasome.
  • Ubiquitinated; which leads to proteasomal degradation. Autoubiquitinated; interaction with USP7 leads to deubiquitination and prevents degradation. Ubiquitination and degradation takes place during M phase, when phosphorylation at Ser-639 prevents intereaction with USP7 and subsequent deubiquitination. Polyubiquitination may be stimulated by DNA damage.
  • Ubiquitination at isoforms=2408, isoforms=2385, posLast=500500, posLast=5050, isoforms=2692, posLast=399399, posLast=600600, posLast=570570, isoforms=231, and isoforms=2525
  • Modification sites at PhosphoSitePlus

Domains & Families for UHRF1 Gene

Gene Families for UHRF1 Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Enzymes
  • Potential drug targets
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for UHRF1 Gene

GenScript: Design optimal peptide antigens:
  • Ubiquitin-like, containing PHD and RING finger domains, 1, isoform CRA_a (A0JBR2_HUMAN)
  • Ubiquitin-like with PHD and ring finger domains 1 (Q2HIX7_HUMAN)
  • Ubiquitin-like-containing PHD and RING finger domains protein 1 (UHRF1_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q96T88

UniProtKB/Swiss-Prot:

UHRF1_HUMAN :
  • The tudor-like regions specifically recognize and bind histone H3 unmethylated at 'Arg-2' (H3R2me0), while the PHD-type zinc finger specifically recognizes and binds histone H3 trimethylated at 'Lys-9' (H3K9me3). The tudor-like regions simultaneously recognizes H3K9me3 through a conserved aromatic cage in the first tudor-like subdomain and unmodified H3K4 (H3K4me0) within a groove between the tandem subdomains (PubMed:21489993, PubMed:21777816 and PubMed:22100450). The linker region plays a role in the formation of a histone H3-binding hole between the reader modules formed by the tudor-like regions and the PHD-type zinc finger by making extended contacts with the tandem tudor-like regions (PubMed:22837395).
Domain:
  • The tudor-like regions specifically recognize and bind histone H3 unmethylated at 'Arg-2' (H3R2me0), while the PHD-type zinc finger specifically recognizes and binds histone H3 trimethylated at 'Lys-9' (H3K9me3). The tudor-like regions simultaneously recognizes H3K9me3 through a conserved aromatic cage in the first tudor-like subdomain and unmodified H3K4 (H3K4me0) within a groove between the tandem subdomains (PubMed:21489993, PubMed:21777816 and PubMed:22100450). The linker region plays a role in the formation of a histone H3-binding hole between the reader modules formed by the tudor-like regions and the PHD-type zinc finger by making extended contacts with the tandem tudor-like regions (PubMed:22837395).
  • The YDG domain (also named SRA domain) specifically recognizes and binds hemimethylated DNA at replication forks (DNA that is only methylated on the mother strand of replicating DNA) (PubMed:17673620). It contains a binding pocket that accommodates the 5-methylcytosine that is flipped out of the duplex DNA. 2 specialized loops reach through the resulting gap in the DNA from both the major and the minor grooves to read the other 3 bases of the CpG duplex. The major groove loop confers both specificity for the CpG dinucleotide and discrimination against methylation of deoxycytidine of the complementary strand (PubMed:18772889). The YDG domain also recognizes and binds 5-hydroxymethylcytosine (5hmC) (PubMed:21731699).
  • The RING finger is required for ubiquitin ligase activity.
genes like me logo Genes that share domains with UHRF1: view

Function for UHRF1 Gene

Molecular function for UHRF1 Gene

UniProtKB/Swiss-Prot Function:
Multidomain protein that acts as a key epigenetic regulator by bridging DNA methylation and chromatin modification. Specifically recognizes and binds hemimethylated DNA at replication forks via its YDG domain and recruits DNMT1 methyltransferase to ensure faithful propagation of the DNA methylation patterns through DNA replication. In addition to its role in maintenance of DNA methylation, also plays a key role in chromatin modification: through its tudor-like regions and PHD-type zinc fingers, specifically recognizes and binds histone H3 trimethylated at 'Lys-9' (H3K9me3) and unmethylated at 'Arg-2' (H3R2me0), respectively, and recruits chromatin proteins. Enriched in pericentric heterochromatin where it recruits different chromatin modifiers required for this chromatin replication. Also localizes to euchromatic regions where it negatively regulates transcription possibly by impacting DNA methylation and histone modifications. Has E3 ubiquitin-protein ligase activity by mediating the ubiquitination of target proteins such as histone H3 and PML. It is still unclear how E3 ubiquitin-protein ligase activity is related to its role in chromatin in vivo. May be involved in DNA repair.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=S-ubiquitinyl-[E2 ubiquitin-conjugating enzyme]-L-cysteine + [acceptor protein]-L-lysine = [E2 ubiquitin-conjugating enzyme]-L-cysteine + N(6)-ubiquitinyl-[acceptor protein]-L-lysine.; EC=2.3.2.27;.
UniProtKB/Swiss-Prot Induction:
Up-regulated in proliferating cells, and down-regulated in quiescent cells. Down-regulated upon adriamycin-induced DNA damage, in a p53/TP53 and CDKN1A-dependent way. Induced by E2F1 transcription factor.

Enzyme Numbers (IUBMB) for UHRF1 Gene

Phenotypes From GWAS Catalog for UHRF1 Gene

Gene Ontology (GO) - Molecular Function for UHRF1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000987 proximal promoter sequence-specific DNA binding IDA 10646863
GO:0003677 DNA binding IEA --
GO:0004842 ubiquitin-protein transferase activity IDA 17967883
GO:0005515 protein binding IPI 15361834
GO:0008270 zinc ion binding IDA 21777816
genes like me logo Genes that share ontologies with UHRF1: view
genes like me logo Genes that share phenotypes with UHRF1: view

Animal Models for UHRF1 Gene

MGI Knock Outs for UHRF1:
  • Uhrf1 Uhrf1<tm1Hko>
  • Uhrf1 Uhrf1<tm1a(EUCOMM)Wtsi>

Animal Model Products

CRISPR Products

Clone Products

  • Applied Biological Materials (abm): Clones for UHRF1 - Now 50% OFF >
  • * UHRF1 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * UHRF1 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
  • Addgene plasmids for UHRF1

No data available for Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for UHRF1 Gene

Localization for UHRF1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for UHRF1 Gene

Nucleus. Note=Localizes to replication foci. Enriched in pericentric heterochromatin. Also localizes to euchromatic regions.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for UHRF1 gene
Compartment Confidence
nucleus 5

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for UHRF1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000790 nuclear chromatin ISS --
GO:0000791 euchromatin IDA 21777816
GO:0000792 heterochromatin IDA 17967883
GO:0005634 nucleus IEA,IDA 10646863
GO:0005657 replication fork IDA 17673620
genes like me logo Genes that share ontologies with UHRF1: view

Pathways & Interactions for UHRF1 Gene

genes like me logo Genes that share pathways with UHRF1: view

Pathways by source for UHRF1 Gene

1 Cell Signaling Technology pathway for UHRF1 Gene

UniProtKB/Swiss-Prot Q96T88-UHRF1_HUMAN

  • Pathway: Protein modification; protein ubiquitination.

SIGNOR curated interactions for UHRF1 Gene

Inactivates:
Is activated by:
Is inactivated by:

Gene Ontology (GO) - Biological Process for UHRF1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription by RNA polymerase II IDA 21777816
GO:0006281 DNA repair IEA --
GO:0006325 chromatin organization IEA --
GO:0006511 ubiquitin-dependent protein catabolic process IDA 22945642
GO:0006974 cellular response to DNA damage stimulus IEA --
genes like me logo Genes that share ontologies with UHRF1: view

Drugs & Compounds for UHRF1 Gene

(3) Drugs for UHRF1 Gene - From: HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Phosphoric acid Approved Pharma 0
Adenosine monophosphate Approved, Investigational Nutra 0
ATP Investigational Nutra Agonist, Activator, Full agonist, Antagonist, Pore Blocker, Potentiation 0

(1) Additional Compounds for UHRF1 Gene - From: HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
pyrophosphate
  • [(ho)2P(O)OP(O)(OH)2]
  • Acide diphosphorique
  • Diphosphorsaeure
  • H4P2O7
  • PYROphosphATE
14000-31-8
genes like me logo Genes that share compounds with UHRF1: view

Transcripts for UHRF1 Gene

Unigene Clusters for UHRF1 Gene

Ubiquitin-like with PHD and ring finger domains 1:
Representative Sequences:

CRISPR Products

Clone Products

  • Applied Biological Materials (abm): Clones for UHRF1 - Now 50% OFF >
  • * UHRF1 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * UHRF1 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
  • Addgene plasmids for UHRF1

Alternative Splicing Database (ASD) splice patterns (SP) for UHRF1 Gene

No ASD Table

Relevant External Links for UHRF1 Gene

GeneLoc Exon Structure for
UHRF1
ECgene alternative splicing isoforms for
UHRF1

Expression for UHRF1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for UHRF1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for UHRF1 Gene

This gene is overexpressed in Bone (32.2) and Plasma (13.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for UHRF1 Gene



Protein tissue co-expression partners for UHRF1 Gene

NURSA nuclear receptor signaling pathways regulating expression of UHRF1 Gene:

UHRF1

SOURCE GeneReport for Unigene cluster for UHRF1 Gene:

Hs.108106

mRNA Expression by UniProt/SwissProt for UHRF1 Gene:

Q96T88-UHRF1_HUMAN
Tissue specificity: Expressed in thymus, bone marrow, testis, lung and heart. Overexpressed in breast cancer.
genes like me logo Genes that share expression patterns with UHRF1: view

No data available for mRNA differential expression in normal tissues , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for UHRF1 Gene

Orthologs for UHRF1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for UHRF1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia UHRF1 34
  • 98.96 (n)
dog
(Canis familiaris)
Mammalia UHRF1 34
  • 85.77 (n)
cow
(Bos Taurus)
Mammalia UHRF1 34
  • 84 (n)
rat
(Rattus norvegicus)
Mammalia Uhrf1 34
  • 75.83 (n)
mouse
(Mus musculus)
Mammalia Uhrf1 17 34
  • 75.68 (n)
chicken
(Gallus gallus)
Aves UHRF1 34
  • 68.16 (n)
tropical clawed frog
(Silurana tropicalis)
Amphibia uhrf1 34
  • 64.29 (n)
Str.3974 34
African clawed frog
(Xenopus laevis)
Amphibia Xl.15117 34
zebrafish
(Danio rerio)
Actinopterygii uhrf1 34
  • 69.53 (n)
wufb97f09 34
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.4344 34
sea squirt
(Ciona savignyi)
Ascidiacea Cin.4344 34
Species where no ortholog for UHRF1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for UHRF1 Gene

ENSEMBL:
Gene Tree for UHRF1 (if available)
TreeFam:
Gene Tree for UHRF1 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for UHRF1: view image

Paralogs for UHRF1 Gene

Paralogs for UHRF1 Gene

(1) SIMAP similar genes for UHRF1 Gene using alignment to 2 proteins:

  • UHRF1_HUMAN
  • L8ECE3_HUMAN

Pseudogenes.org Pseudogenes for UHRF1 Gene

genes like me logo Genes that share paralogs with UHRF1: view

Variants for UHRF1 Gene

Sequence variations from dbSNP and Humsavar for UHRF1 Gene

SNP ID Clin Chr 19 pos Variation AA Info Type
rs1000145592 -- 4,942,741(+) T/C intron_variant
rs1000174559 -- 4,943,118(+) T/A/C intron_variant
rs1000175730 -- 4,942,543(+) G/T intron_variant
rs1000177662 -- 4,923,485(+) TGGCTGCCCCTGGCTGCCCC/TGGCTGCCCCTGGCTGCCCCTGGCTGCCCC intron_variant
rs1000199938 -- 4,912,238(+) G/A intron_variant

Structural Variations from Database of Genomic Variants (DGV) for UHRF1 Gene

Variant ID Type Subtype PubMed ID
esv3643519 CNV loss 21293372
nsv1065556 CNV loss 25217958
nsv518075 CNV loss 19592680

Additional Variant Information for UHRF1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
UHRF1

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for UHRF1 Gene

Disorders for UHRF1 Gene

MalaCards: The human disease database

(3) MalaCards diseases for UHRF1 Gene - From: LncRNADisease and DISEASES

- elite association - COSMIC cancer census association via MalaCards
Search UHRF1 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

UHRF1_HUMAN
  • Note=Defects in UHRF1 may be a cause of cancers. Overexpressed in many different forms of human cancers, including bladder, breast, cervical, colorectal and prostate cancers, as well as pancreatic adenocarcinomas, rhabdomyosarcomas and gliomas. Plays an important role in the correlation of histone modification and gene silencing in cancer progression. Expression is associated with a poor prognosis in patients with various cancers, suggesting that it participates in cancer progression.

Additional Disease Information for UHRF1

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with UHRF1: view

No data available for Genatlas for UHRF1 Gene

Publications for UHRF1 Gene

  1. ICBP90, a novel human CCAAT binding protein, involved in the regulation of topoisomerase IIalpha expression. (PMID: 10646863) Hopfner R … Bronner C (Cancer research 2000) 2 3 4 23 58
  2. UHRF1 binds G9a and participates in p21 transcriptional regulation in mammalian cells. (PMID: 19056828) Kim JK … Pradhan S (Nucleic acids research 2009) 3 4 23 58
  3. UHRF1 is a novel molecular marker for diagnosis and the prognosis of bladder cancer. (PMID: 19491893) Unoki M … Hamamoto R (British journal of cancer 2009) 3 4 23 58
  4. Structure and hemimethylated CpG binding of the SRA domain from human UHRF1. (PMID: 18945682) Qian C … Zhou MM (The Journal of biological chemistry 2008) 3 4 23 58
  5. UHRF1 plays a role in maintaining DNA methylation in mammalian cells. (PMID: 17673620) Bostick M … Jacobsen SE (Science (New York, N.Y.) 2007) 3 4 23 58

Products for UHRF1 Gene

Sources for UHRF1 Gene

Content
Loading form....