Free for academic non-profit institutions. Other users need a Commercial license

Aliases for UBE3A Gene

Aliases for UBE3A Gene

  • Ubiquitin Protein Ligase E3A 2 3 5
  • Human Papilloma Virus E6-Associated Protein 2 3
  • Human Papillomavirus E6-Associated Protein 3 4
  • Oncogenic Protein-Associated Protein E6-AP 3 4
  • HECT-Type Ubiquitin Transferase E3A 3 4
  • Renal Carcinoma Antigen NY-REN-54 3 4
  • E6AP Ubiquitin-Protein Ligase 3 4
  • EPVE6AP 3 4
  • HPVE6A 3 4
  • Ubiquitin-Protein Ligase E3A 3
  • CTCL Tumor Antigen Se37-2 3
  • Angelman Syndrome 2
  • EC 4
  • E6-AP 3
  • ANCR 3
  • E6AP 4
  • AS 3

External Ids for UBE3A Gene

Previous HGNC Symbols for UBE3A Gene

  • HPVE6A

Previous GeneCards Identifiers for UBE3A Gene

  • GC15M021711
  • GC15M018295
  • GC15M023000
  • GC15M023129
  • GC15M023133
  • GC15M025582
  • GC15M003706

Summaries for UBE3A Gene

Entrez Gene Summary for UBE3A Gene

  • This gene encodes an E3 ubiquitin-protein ligase, part of the ubiquitin protein degradation system. This imprinted gene is maternally expressed in brain and biallelically expressed in other tissues. Maternally inherited deletion of this gene causes Angelman Syndrome, characterized by severe motor and intellectual retardation, ataxia, hypotonia, epilepsy, absence of speech, and characteristic facies. The protein also interacts with the E6 protein of human papillomavirus types 16 and 18, resulting in ubiquitination and proteolysis of tumor protein p53. Alternative splicing of this gene results in three transcript variants encoding three isoforms with different N-termini. Additional transcript variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]

GeneCards Summary for UBE3A Gene

UBE3A (Ubiquitin Protein Ligase E3A) is a Protein Coding gene. Diseases associated with UBE3A include Angelman Syndrome and Angelman Syndrome Due To A Point Mutation. Among its related pathways are Class I MHC mediated antigen processing and presentation and Protein ubiquitination. Gene Ontology (GO) annotations related to this gene include ligase activity and transcription coactivator activity. An important paralog of this gene is HECTD2.

UniProtKB/Swiss-Prot for UBE3A Gene

  • E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and transfers it to its substrates (PubMed:10373495, PubMed:16772533, PubMed:19204938, PubMed:19233847, PubMed:19325566, PubMed:19591933, PubMed:22645313, PubMed:24273172, PubMed:24728990). Several substrates have been identified including the ARNTL/BMAL1, ARC, RAD23A and RAD23B, MCM7 (which is involved in DNA replication), annexin A1, the PML tumor suppressor, and the cell cycle regulator CDKN1B (PubMed:10373495, PubMed:19204938, PubMed:19325566, PubMed:19591933, PubMed:22645313, PubMed:24728990). Additionally, may function as a cellular quality control ubiquitin ligase by helping the degradation of the cytoplasmic misfolded proteins (PubMed:19233847). Finally, UBE3A also promotes its own degradation in vivo. Plays an important role in the regulation of the circadian clock: involved in the ubiquitination of the core clock component ARNTL/BMAL1, leading to its proteasomal degradation (PubMed:24728990). Acts as transcriptional coactivator of progesterone receptor PGR upon progesterone hormone activation (PubMed:16772533). Acts as a regulator of synaptic development by mediating ubiquitination and degradation of ARC (By similarity). Synergizes with WBP2 in enhancing PGR activity (PubMed:16772533).

  • (Microbial infection) Catalyzes the high-risk human papilloma virus E6-mediated ubiquitination of p53/TP53, contributing to the neoplastic progression of cells infected by these viruses.

Gene Wiki entry for UBE3A Gene

Additional gene information for UBE3A Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for UBE3A Gene

Genomics for UBE3A Gene

GeneHancer (GH) Regulatory Elements for UBE3A Gene

Promoters and enhancers for UBE3A Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH15J025436 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 650.7 +0.8 773 3.6 PKNOX1 ATF1 FOXA2 ARID4B SIN3A DMAP1 ZNF48 YY1 POLR2B ZNF766 UBE3A GC15P025980
GH15J026081 Enhancer 1.2 Ensembl ENCODE 10.2 -643.7 -643734 2.1 PKNOX1 FOXA2 ARNT SIN3A DMAP1 YY1 SLC30A9 POLR2B FOS SP5 GC15M026083 TRE-TTC2-2 UBE3A ENSG00000261529 LINC00929
GH15J025391 Enhancer 0.7 Ensembl ENCODE 10.8 +46.5 46535 1.6 JUND CEBPB CEBPG FOS PRDM1 UBE3A GC15P025980 ENSG00000261529 SNHG14
GH15J025481 Enhancer 0.6 Ensembl ENCODE 11 -42.6 -42602 0.6 GATA3 POLR2A BACH1 UBE3A LINC02250
GH15J025858 Promoter/Enhancer 1.9 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 3.1 -422.3 -422295 5.7 HDAC2 ZFX EZH2 NR2F2 ATP10A LOC105370738 UBE3A MIR4715
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around UBE3A on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the UBE3A gene promoter:
  • AP-1
  • c-Jun
  • ATF-2

Genomic Locations for UBE3A Gene

Genomic Locations for UBE3A Gene
105,329 bases
Minus strand
101,795 bases
Minus strand

Genomic View for UBE3A Gene

Genes around UBE3A on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
UBE3A Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for UBE3A Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for UBE3A Gene

Proteins for UBE3A Gene

  • Protein details for UBE3A Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Ubiquitin-protein ligase E3A
    Protein Accession:
    Secondary Accessions:
    • A8K8Z9
    • P78355
    • Q93066
    • Q9UEP4
    • Q9UEP5
    • Q9UEP6
    • Q9UEP7
    • Q9UEP8
    • Q9UEP9

    Protein attributes for UBE3A Gene

    875 amino acids
    Molecular mass:
    100688 Da
    Quaternary structure:
    • The active form is probably a homotrimer. Binds UBQLN1 and UBQLN2. Interacts with the 26S proteasome. Interacts with BPY2. Interacts with HIF1AN, MAPK6 AND NEURL4; interaction with MAPK6 may be mediated by NEURL4. Interacts with the proteasomal subunit PSMD4. Interacts with ESR1 and WBP2 (PubMed:16772533, PubMed:21642474). Interacts with ARNTL/BMAL1 (PubMed:24728990). Interacts with ARC (By similarity).
    • (Microbial infection) Interacts with HCV core protein and targets it to degradation.
    • (Microbial infection) Interacts with the E6 protein of the cancer-associated human papillomavirus types 16 and 18. The E6/E6-AP complex binds to and targets the p53/TP53 tumor-suppressor protein for ubiquitin-mediated proteolysis.
    • A cysteine residue is required for ubiquitin-thioester formation.

    Three dimensional structures from OCA and Proteopedia for UBE3A Gene

    Alternative splice isoforms for UBE3A Gene


neXtProt entry for UBE3A Gene

Post-translational modifications for UBE3A Gene

  • Phosphorylation at Tyr-659 by ABL1 impairs E3 ligase activity and protects p53/TP53 from degradation in (HPV)-infected cells.
  • Ubiquitination at posLast=870870, isoforms=2, 3829, posLast=824824, isoforms=2, 3822, posLast=802802, isoforms=2, 3728, isoforms=2, 3724, posLast=711711, posLast=468468, isoforms=2, 3421, isoforms=2, 3373, posLast=350350, posLast=330330, isoforms=2, 3323, isoforms=2, 3226, isoforms=2, 3132, posLast=123123, posLast=101101, posLast=7777, isoforms=2, 371, and posLast=3030
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for UBE3A Gene

Domains & Families for UBE3A Gene

Gene Families for UBE3A Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Enzymes
  • Potential drug targets
  • Predicted intracellular proteins
  • Predicted membrane proteins

Protein Domains for UBE3A Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with UBE3A: view

No data available for UniProtKB/Swiss-Prot for UBE3A Gene

Function for UBE3A Gene

Molecular function for UBE3A Gene

UniProtKB/Swiss-Prot Function:
E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and transfers it to its substrates (PubMed:10373495, PubMed:16772533, PubMed:19204938, PubMed:19233847, PubMed:19325566, PubMed:19591933, PubMed:22645313, PubMed:24273172, PubMed:24728990). Several substrates have been identified including the ARNTL/BMAL1, ARC, RAD23A and RAD23B, MCM7 (which is involved in DNA replication), annexin A1, the PML tumor suppressor, and the cell cycle regulator CDKN1B (PubMed:10373495, PubMed:19204938, PubMed:19325566, PubMed:19591933, PubMed:22645313, PubMed:24728990). Additionally, may function as a cellular quality control ubiquitin ligase by helping the degradation of the cytoplasmic misfolded proteins (PubMed:19233847). Finally, UBE3A also promotes its own degradation in vivo. Plays an important role in the regulation of the circadian clock: involved in the ubiquitination of the core clock component ARNTL/BMAL1, leading to its proteasomal degradation (PubMed:24728990). Acts as transcriptional coactivator of progesterone receptor PGR upon progesterone hormone activation (PubMed:16772533). Acts as a regulator of synaptic development by mediating ubiquitination and degradation of ARC (By similarity). Synergizes with WBP2 in enhancing PGR activity (PubMed:16772533).
UniProtKB/Swiss-Prot Function:
(Microbial infection) Catalyzes the high-risk human papilloma virus E6-mediated ubiquitination of p53/TP53, contributing to the neoplastic progression of cells infected by these viruses.
UniProtKB/Swiss-Prot CatalyticActivity:
S-ubiquitinyl-[E2 ubiquitin-conjugating enzyme]-L-cysteine + [acceptor protein]-L-lysine = [E2 ubiquitin-conjugating enzyme]-L-cysteine + N(6)-ubiquitinyl-[acceptor protein]-L-lysine.
GENATLAS Biochemistry:
ubiquitin protein ligase E3A,recognin,mediating the interaction of the human papilloma virus E6 oncoprotein with TP53 nuclear hormone coactivator receptors,paternally imprinted in brain,mutated in Angelman syndrome,homologous to Drosophila bendless,Dres32,mouse homolog,expressed at high levels in all embryonic structures,playing a major role in neural development,involved in the degradation of short-lived and abnormal proteins

Enzyme Numbers (IUBMB) for UBE3A Gene

Phenotypes From GWAS Catalog for UBE3A Gene

Gene Ontology (GO) - Molecular Function for UBE3A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003713 transcription coactivator activity IEA --
GO:0004842 ubiquitin-protein transferase activity IDA,IEA 12890688
GO:0005515 protein binding IPI 7624774
GO:0016740 transferase activity IEA --
GO:0016874 ligase activity IEA --
genes like me logo Genes that share ontologies with UBE3A: view
genes like me logo Genes that share phenotypes with UBE3A: view

Human Phenotype Ontology for UBE3A Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for UBE3A Gene

MGI Knock Outs for UBE3A:

Animal Model Products

Clone Products

  • Addgene plasmids for UBE3A

No data available for Transcription Factor Targets and HOMER Transcription for UBE3A Gene

Localization for UBE3A Gene

Subcellular locations from UniProtKB/Swiss-Prot for UBE3A Gene

Cytoplasm. Nucleus.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for UBE3A gene
Compartment Confidence
nucleus 5
cytosol 5
mitochondrion 1
peroxisome 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Nucleoplasm (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for UBE3A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000502 proteasome complex IEA --
GO:0005634 nucleus IEA --
GO:0005737 cytoplasm IBA --
GO:0005829 cytosol IEA --
genes like me logo Genes that share ontologies with UBE3A: view

Pathways & Interactions for UBE3A Gene

genes like me logo Genes that share pathways with UBE3A: view

UniProtKB/Swiss-Prot Q05086-UBE3A_HUMAN

  • Pathway: Protein modification; protein ubiquitination.

Gene Ontology (GO) - Biological Process for UBE3A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000209 protein polyubiquitination IBA --
GO:0001541 ovarian follicle development IEA --
GO:0006508 proteolysis TAS 8221889
GO:0006511 ubiquitin-dependent protein catabolic process IEA,TAS --
GO:0007420 brain development TAS 8988171
genes like me logo Genes that share ontologies with UBE3A: view

No data available for SIGNOR curated interactions for UBE3A Gene

Drugs & Compounds for UBE3A Gene

(12) Drugs for UBE3A Gene - From: HMDB and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Phosphoric acid Approved Pharma 0
Adenosine monophosphate Approved, Investigational Nutra 0
ATP Investigational Nutra Agonist, Activator, Full agonist, Antagonist, Potentiation, Pore Blocker 0

(5) Additional Compounds for UBE3A Gene - From: Novoseek and HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • [(ho)2P(O)OP(O)(OH)2]
  • Acide diphosphorique
  • Diphosphorsaeure
  • H4P2O7
  • PYROphosphATE
genes like me logo Genes that share compounds with UBE3A: view

Transcripts for UBE3A Gene

mRNA/cDNA for UBE3A Gene

Unigene Clusters for UBE3A Gene

Ubiquitin protein ligase E3A:
Representative Sequences:

Clone Products

  • Addgene plasmids for UBE3A

Alternative Splicing Database (ASD) splice patterns (SP) for UBE3A Gene

ExUns: 1a · 1b · 1c · 1d ^ 2 ^ 3a · 3b ^ 4 ^ 5 ^ 6a · 6b ^ 7 ^ 8a · 8b · 8c · 8d · 8e ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14a · 14b ^ 15 ^ 16 ^
SP2: - - - -
SP3: - - -
SP6: -
SP7: -
SP8: - - - - - -
SP10: - - - - - - -
SP11: -

ExUns: 17

Relevant External Links for UBE3A Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for UBE3A Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for UBE3A Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for UBE3A Gene

This gene is overexpressed in Muscle - Skeletal (x4.1).

Protein differential expression in normal tissues from HIPED for UBE3A Gene

This gene is overexpressed in Lymph node (10.7) and Peripheral blood mononuclear cells (8.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for UBE3A Gene

Protein tissue co-expression partners for UBE3A Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of UBE3A Gene:


SOURCE GeneReport for Unigene cluster for UBE3A Gene:


Evidence on tissue expression from TISSUES for UBE3A Gene

  • Nervous system(4.9)
  • Skin(4.4)
  • Lung(2.4)
  • Muscle(2.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for UBE3A Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • digestive
  • integumentary
  • nervous
  • respiratory
  • skeletal muscle
  • skeleton
Head and neck:
  • brain
  • cranial nerve
  • eye
  • face
  • head
  • jaw
  • lip
  • mandible
  • maxilla
  • mouth
  • salivary gland
  • skull
  • tongue
  • tooth
  • lung
  • rib
  • rib cage
  • intestine
  • large intestine
  • pelvis
  • rectum
  • lower limb
  • upper limb
  • hair
  • peripheral nerve
  • peripheral nervous system
  • skin
  • spinal column
  • spinal cord
  • vertebrae
genes like me logo Genes that share expression patterns with UBE3A: view

No data available for mRNA Expression by UniProt/SwissProt for UBE3A Gene

Orthologs for UBE3A Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for UBE3A Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia UBE3A 34 33
  • 99.92 (n)
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 96 (a)
-- 34
  • 84 (a)
(Canis familiaris)
Mammalia UBE3A 34 33
  • 95.8 (n)
(Bos Taurus)
Mammalia UBE3A 34 33
  • 95.33 (n)
(Monodelphis domestica)
Mammalia UBE3A 34
  • 95 (a)
(Mus musculus)
Mammalia Ube3a 16 34 33
  • 93.56 (n)
(Rattus norvegicus)
Mammalia Ube3a 33
  • 93.12 (n)
(Gallus gallus)
Aves UBE3A 34 33
  • 88.42 (n)
(Anolis carolinensis)
Reptilia UBE3A 34
  • 93 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia ube3a 33
  • 82.36 (n)
(Danio rerio)
Actinopterygii ube3a 34 33
  • 75.98 (n)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP012366 33
  • 51.97 (n)
fruit fly
(Drosophila melanogaster)
Insecta Ube3a 34 33
  • 50.42 (n)
CG6190 35
  • 42 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes HUL4 34
  • 23 (a)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.429 34
  • 44 (a)
Species where no ortholog for UBE3A was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for UBE3A Gene

Gene Tree for UBE3A (if available)
Gene Tree for UBE3A (if available)
Evolutionary constrained regions (ECRs) for UBE3A: view image

Paralogs for UBE3A Gene

(16) SIMAP similar genes for UBE3A Gene using alignment to 7 proteins:

  • Q5W7F7_HUMAN
  • Q96GR7_HUMAN
  • Q9H2G0_HUMAN
  • S4R306_HUMAN Pseudogenes for UBE3A Gene

genes like me logo Genes that share paralogs with UBE3A: view

Variants for UBE3A Gene

Sequence variations from dbSNP and Humsavar for UBE3A Gene

SNP ID Clin Chr 15 pos Variation AA Info Type
rs1057518770 pathogenic, Abnormality of the corpus callosum, EEG abnormality, Expressive language delay, Global developmental delay, Poor speech, Seizures 25,354,536(-) C/T coding_sequence_variant, intron_variant, missense_variant
rs1057518777 likely-pathogenic, Developmental delay, Intellectual disability 25,339,240(-) GTATGAGATGTAGGTA/GTATGAGATGTAGGTATGAGATGTAGGTA coding_sequence_variant, frameshift
rs1057519062 pathogenic, Angelman syndrome 25,339,187(-) CTTTAAGTTTTTCTTTGCTT/CTT coding_sequence_variant, frameshift
rs1060504406 likely-benign, Angelman syndrome 25,371,442(-) G/A coding_sequence_variant, synonymous_variant
rs1064792950 pathogenic, Angelman syndrome 25,339,205(-) TTGAGTATTCCGGAAGT/ coding_sequence_variant, frameshift

Structural Variations from Database of Genomic Variants (DGV) for UBE3A Gene

Variant ID Type Subtype PubMed ID
esv1788582 CNV insertion 17803354
esv33464 CNV gain 17666407
esv3443008 CNV insertion 20981092
esv3569331 CNV gain 25503493
esv994643 CNV deletion 20482838
nsv1036180 CNV gain 25217958
nsv1127418 CNV deletion 24896259
nsv1468 CNV insertion 18451855
nsv832937 CNV loss 17160897
nsv976900 CNV duplication 23825009
nsv984032 CNV duplication 23825009

Variation tolerance for UBE3A Gene

Residual Variation Intolerance Score: 5.11% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.09; 22.22% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for UBE3A Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for UBE3A Gene

Disorders for UBE3A Gene

MalaCards: The human disease database

(22) MalaCards diseases for UBE3A Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search UBE3A in MalaCards View complete list of genes associated with diseases


  • Angelman syndrome (AS) [MIM:105830]: A neurodevelopmental disorder characterized by severe motor and intellectual retardation, ataxia, frequent jerky limb movements and flapping of the arms and hands, hypotonia, seizures, absence of speech, frequent smiling and episodes of paroxysmal laughter, open-mouthed expression revealing the tongue. {ECO:0000269 PubMed:25212744, ECO:0000269 PubMed:9585605}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for UBE3A

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with UBE3A: view

No data available for Genatlas for UBE3A Gene

Publications for UBE3A Gene

  1. Identification of annexin A1 as a novel substrate for E6AP-mediated ubiquitylation. (PMID: 19204938) Shimoji T … Shoji I (Journal of cellular biochemistry 2009) 3 4 22 58
  2. The ubiquitin ligase E6-AP is induced and recruited to aggresomes in response to proteasome inhibition and may be involved in the ubiquitination of Hsp70-bound misfolded proteins. (PMID: 19233847) Mishra A … Jana NR (The Journal of biological chemistry 2009) 3 4 22 58
  3. E6AP promotes the degradation of the PML tumor suppressor. (PMID: 19325566) Louria-Hayon I … Haupt Y (Cell death and differentiation 2009) 3 4 22 58
  4. UBE3A gene mutations in Finnish Angelman syndrome patients detected by conformation sensitive gel electrophoresis. (PMID: 15054837) Rapakko K … Leisti J (American journal of medical genetics. Part A 2004) 3 22 44 58
  5. VCY2 protein interacts with the HECT domain of ubiquitin-protein ligase E3A. (PMID: 12207887) Wong EY … Yeung WS (Biochemical and biophysical research communications 2002) 3 4 22 58

Products for UBE3A Gene

Sources for UBE3A Gene

Loading form....