Free for academic non-profit institutions. Other users need a Commercial license

TXNL4A Gene(Protein Coding)

Thioredoxin Like 4A

GCID:
GC18M079970
GIFtS:
51
Genes Participants
UDN Logo

Aliases for TXNL4A Gene

Aliases for TXNL4A Gene

  • Thioredoxin Like 4A 2 3 5
  • Spliceosomal U5 SnRNP-Specific 15 KDa Protein 3 4
  • Thioredoxin-Like U5 SnRNP Protein U5-15kD 3 4
  • DIM1 Protein Homolog 3 4
  • Thioredoxin-Like 4 2 3
  • TXNL4 3 4
  • DIM1 3 4
  • Thioredoxin-Like Protein 4A 3
  • Similar To S. Pombe Dim1+ 2
  • Thioredoxin-Like 4A 2
  • SNRNP15 3
  • U5-15kD 3
  • BMKS 3
  • DIB1 3

External Ids for TXNL4A Gene

Previous HGNC Symbols for TXNL4A Gene

  • TXNL4

Previous GeneCards Identifiers for TXNL4A Gene

  • GC18M075833
  • GC18M077732
  • GC18M074354

Summaries for TXNL4A Gene

Entrez Gene Summary for TXNL4A Gene

  • The protein encoded by this gene is a member of the U5 small ribonucleoprotein particle (snRNP), and is involved in pre-mRNA splicing. This protein contains a thioredoxin-like fold and it is expected to interact with multiple proteins. Protein-protein interactions have been observed with the polyglutamine tract-binding protein 1 (PQBP1). Mutations in both the coding region and promoter region of this gene have been associated with Burn-McKeown syndrome, which is a rare disorder characterized by craniofacial dysmorphisms, cardiac defects, hearing loss, and bilateral choanal atresia. A pseudogene of this gene is found on chromosome 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]

GeneCards Summary for TXNL4A Gene

TXNL4A (Thioredoxin Like 4A) is a Protein Coding gene. Diseases associated with TXNL4A include Burn-Mckeown Syndrome and Choanal Atresia-Hearing Loss-Cardiac Defects-Craniofacial Dysmorphism Syndrome. Among its related pathways are mRNA Splicing - Major Pathway and Gene Expression. An important paralog of this gene is TXNL4B.

UniProtKB/Swiss-Prot for TXNL4A Gene

  • Essential role in pre-mRNA splicing as component of the U5 snRNP and U4/U6-U5 tri-snRNP complexes that are involved in spliceosome assembly.

Gene Wiki entry for TXNL4A Gene

Additional gene information for TXNL4A Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TXNL4A Gene

Genomics for TXNL4A Gene

Products:

  1. Regulatory Element

GeneHancer (GH) Regulatory Elements for TXNL4A Gene

Promoters and enhancers for TXNL4A Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH18I079986 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 592.4 +45.9 45877 3.5 PKNOX1 ATF1 SMAD1 MLX ARID4B SIN3A DMAP1 ZNF48 ETS1 POLR2B TXNL4A RBFADN ENSG00000267251 CTDP1 RBFA HSBP1L1
GH18I080032 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 583.3 -0.4 -369 3.1 HDGF PKNOX1 ARID4B SIN3A FEZF1 DMAP1 ZNF2 YY1 ZNF213 ZNF207 TXNL4A RBFA ENSG00000267127 RBFADN CTDP1 ENSG00000267251 ADNP2 HSBP1L1 PQLC1
GH18I079985 Enhancer 0.7 ENCODE 43.6 +48.2 48222 0.3 ZNF511 MLX SP5 FOXA3 MXD4 MNT DMAP1 KMT2B SKI ZGPAT TXNL4A HSBP1L1
GH18I079949 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE dbSUPER 13.4 +83.0 82995 3.9 FOXA2 ATF1 RB1 ARID4B SIN3A ZBTB40 KLF5 BRCA1 ZNF48 ZNF335 PQLC1 RBFADN TXNL4A HSBP1L1 RBFA PIR48786 GC18M079920
GH18I080006 Enhancer 0.4 ENCODE 53.8 +27.0 27033 0.2 USF1 MAX POU5F1 TXNL4A PQLC1 HSBP1L1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around TXNL4A on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the TXNL4A gene promoter:

Genomic Locations for TXNL4A Gene

Genomic Locations for TXNL4A Gene
chr18:79,970,811-80,033,949
(GRCh38/hg38)
Size:
63,139 bases
Orientation:
Minus strand
chr18:77,732,867-77,793,949
(GRCh37/hg19)

Genomic View for TXNL4A Gene

Genes around TXNL4A on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TXNL4A Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TXNL4A Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for TXNL4A Gene

Proteins for TXNL4A Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for TXNL4A Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P83876-TXN4A_HUMAN
    Recommended name:
    Thioredoxin-like protein 4A
    Protein Accession:
    P83876
    Secondary Accessions:
    • B2RC18
    • O14834

    Protein attributes for TXNL4A Gene

    Size:
    142 amino acids
    Molecular mass:
    16786 Da
    Quaternary structure:
    • Interacts with HNRPF, HNRPH2, NEDD9, ERBB4, and PQBP1. Component of the U5 snRNP complex. Component of the U4/U6-U5 tri-snRNP complex composed of the U4, U6 and U5 snRNAs and at least PRPF3, PRPF4, PRPF6, PRPF8, PRPF31, SNRNP200, TXNL4A, SNRNP40, DDX23, CD2BP2, PPIH, SNU13, EFTUD2, SART1 and USP39. Directly interacts with CD2BP2.

    Three dimensional structures from OCA and Proteopedia for TXNL4A Gene

neXtProt entry for TXNL4A Gene

Protein Expression for TXNL4A Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for TXNL4A Gene

  • The disulfide bond seen in structures determined by X-ray crystallography (PubMed:10610776) and NMR (PubMed:12911302) is not essential for protein folding and function (PubMed:12911302 and PubMed:17467737).
  • Ubiquitination at posLast=139139
  • Modification sites at PhosphoSitePlus

Other Protein References for TXNL4A Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for TXNL4A Gene

Domains & Families for TXNL4A Gene

Gene Families for TXNL4A Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for TXNL4A Gene

InterPro:
Blocks:
ProtoNet:

Suggested Antigen Peptide Sequences for TXNL4A Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

P83876

UniProtKB/Swiss-Prot:

TXN4A_HUMAN :
  • Belongs to the DIM1 family.
Family:
  • Belongs to the DIM1 family.
genes like me logo Genes that share domains with TXNL4A: view

Function for TXNL4A Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for TXNL4A Gene

UniProtKB/Swiss-Prot Function:
Essential role in pre-mRNA splicing as component of the U5 snRNP and U4/U6-U5 tri-snRNP complexes that are involved in spliceosome assembly.

Gene Ontology (GO) - Molecular Function for TXNL4A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 15840814
genes like me logo Genes that share ontologies with TXNL4A: view
genes like me logo Genes that share phenotypes with TXNL4A: view

Human Phenotype Ontology for TXNL4A Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

  • Taconic Biosciences Mouse Models for TXNL4A

CRISPR Products

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Animal Models , Transcription Factor Targets and HOMER Transcription for TXNL4A Gene

Localization for TXNL4A Gene

Subcellular locations from UniProtKB/Swiss-Prot for TXNL4A Gene

Nucleus.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TXNL4A gene
Compartment Confidence
nucleus 5
cytosol 5

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Nuclear membrane (2)
  • Nucleus (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for TXNL4A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IDA --
GO:0005654 nucleoplasm TAS --
GO:0005681 spliceosomal complex IEA,TAS 10610776
GO:0005682 U5 snRNP IBA --
GO:0005737 cytoplasm IDA --
genes like me logo Genes that share ontologies with TXNL4A: view

Pathways & Interactions for TXNL4A Gene

genes like me logo Genes that share pathways with TXNL4A: view

Pathways by source for TXNL4A Gene

1 BioSystems pathway for TXNL4A Gene
1 KEGG pathway for TXNL4A Gene

Gene Ontology (GO) - Biological Process for TXNL4A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000245 spliceosomal complex assembly TAS 10610776
GO:0000375 RNA splicing, via transesterification reactions TAS 10610776
GO:0000398 mRNA splicing, via spliceosome IEA,TAS --
GO:0006397 mRNA processing IEA --
GO:0007049 cell cycle IEA --
genes like me logo Genes that share ontologies with TXNL4A: view

No data available for SIGNOR curated interactions for TXNL4A Gene

Drugs & Compounds for TXNL4A Gene

Products:

  1. Drug
No Compound Related Data Available

Transcripts for TXNL4A Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for TXNL4A Gene

(5) REFSEQ mRNAs :
(8) Additional mRNA sequences :
(225) Selected AceView cDNA sequences:
(12) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for TXNL4A Gene

Thioredoxin-like 4A:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for TXNL4A Gene

ExUns: 1a · 1b · 1c ^ 2a · 2b ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7a · 7b · 7c · 7d · 7e
SP1: - - -
SP2: - - - - -
SP3: - - - - -
SP4: - - - -
SP5: - - - - - -
SP6: - - - - - - -
SP7: - - -
SP8:
SP9: - - - -
SP10: - - - - - - -
SP11: - - - - -

Relevant External Links for TXNL4A Gene

GeneLoc Exon Structure for
TXNL4A
ECgene alternative splicing isoforms for
TXNL4A

Expression for TXNL4A Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TXNL4A Gene

mRNA expression in normal human tissues for TXNL4A Gene
mRNA expression by BioGPS for TXNL4A GenemRNA expression by GTEx for TXNL4A Gene

Protein differential expression in normal tissues from HIPED for TXNL4A Gene

This gene is overexpressed in Pancreas (9.0) and CD4 Tcells (8.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for TXNL4A Gene



Protein tissue co-expression partners for TXNL4A Gene

NURSA nuclear receptor signaling pathways regulating expression of TXNL4A Gene:

TXNL4A

SOURCE GeneReport for Unigene cluster for TXNL4A Gene:

Hs.465498

Evidence on tissue expression from TISSUES for TXNL4A Gene

  • Liver(4.6)
  • Nervous system(4.6)
  • Lung(4.3)

Phenotype-based relationships between genes and organs from Gene ORGANizer for TXNL4A Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • integumentary
  • nervous
  • respiratory
  • skeletal muscle
  • skeleton
  • urinary
Regions:
Head and neck:
  • chin
  • ear
  • eye
  • eyelid
  • face
  • head
  • jaw
  • lip
  • mandible
  • maxilla
  • middle ear
  • mouth
  • nose
  • outer ear
  • pharynx
  • skull
  • tooth
Thorax:
  • heart
  • heart valve
  • lung
Abdomen:
  • kidney
Limb:
  • foot
  • lower limb
  • toe
General:
  • blood vessel
  • skin
genes like me logo Genes that share expression patterns with TXNL4A: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for TXNL4A Gene

Orthologs for TXNL4A Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for TXNL4A Gene

Organism Taxonomy Gene Similarity Type Details
oppossum
(Monodelphis domestica)
 Mammalia -- 34
  • 99 (a)
 ManyToMany
platypus
(Ornithorhynchus anatinus)
 Mammalia TXNL4A 34
  • 99 (a)
 OneToOne
chimpanzee
(Pan troglodytes)
 Mammalia TXNL4A 33 34
  • 94.99 (n)
dog
(Canis familiaris)
 Mammalia TXNL4A 33 34
  • 92.25 (n)
cow
(Bos Taurus)
 Mammalia TXNL4A 33 34
  • 91.55 (n)
mouse
(Mus musculus)
 Mammalia Txnl4a 33 16 34
  • 89.91 (n)
rat
(Rattus norvegicus)
 Mammalia LOC100911462 33
  • 89.91 (n)
chicken
(Gallus gallus)
 Aves -- 34
  • 99 (a)
 ManyToMany
TXNL4A 33
  • 83.57 (n)
lizard
(Anolis carolinensis)
 Reptilia -- 34
  • 99 (a)
 ManyToMany
-- 34
  • 99 (a)
 ManyToMany
tropical clawed frog
(Silurana tropicalis)
 Amphibia txnl4a 33
  • 81.46 (n)
Str.47 33
African clawed frog
(Xenopus laevis)
 Amphibia Xl.8119 33
zebrafish
(Danio rerio)
 Actinopterygii txnl4a 33 34
  • 81.69 (n)
Dr.23353 33
rainbow trout
(Oncorhynchus mykiss)
 Actinopterygii Omy.11084 33
fruit fly
(Drosophila melanogaster)
 Insecta Dim1 33 34
  • 83.33 (n)
African malaria mosquito
(Anopheles gambiae)
 Insecta AgaP_AGAP008298 33
  • 81.69 (n)
worm
(Caenorhabditis elegans)
 Secernentea Y54G2A.75 34
  • 87 (a)
 OneToMany
A. gosspyii yeast
(Ashbya gossypii)
 Saccharomycetes AGOS_ADL374W 33
  • 71.01 (n)
K. lactis yeast
(Kluyveromyces lactis)
 Saccharomycetes KLLA0B08910g 33
  • 64.73 (n)
baker's yeast
(Saccharomyces cerevisiae)
 Saccharomycetes DIB1 33 34 36
  • 60.87 (n)
thale cress
(Arabidopsis thaliana)
 eudicotyledons YLS8 33
  • 75.35 (n)
soybean
(Glycine max)
 eudicotyledons Gma.1488 33
Alicante grape
(Vitis vinifera)
 eudicotyledons Vvi.8794 33
rice
(Oryza sativa)
 Liliopsida Os10g0486600 33
  • 77.7 (n)
Os.12368 33
barley
(Hordeum vulgare)
 Liliopsida Hv.3702 33
corn
(Zea mays)
 Liliopsida Zm.17080 33
sea squirt
(Ciona savignyi)
 Ascidiacea CSA.9800 34
  • 89 (a)
 OneToMany
bread mold
(Neurospora crassa)
 Ascomycetes NCU08395 33
  • 75.12 (n)
fission yeast
(Schizosaccharomyces pombe)
 Schizosaccharomycetes dim1 33
  • 65.26 (n)
sea squirt
(Ciona intestinalis)
 Ascidiacea Cin.2538 33
Species where no ortholog for TXNL4A was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for TXNL4A Gene

ENSEMBL:
Gene Tree for TXNL4A (if available)
TreeFam:
Gene Tree for TXNL4A (if available)

Paralogs for TXNL4A Gene

Paralogs for TXNL4A Gene

(1) SIMAP similar genes for TXNL4A Gene using alignment to 7 proteins:

Pseudogenes.org Pseudogenes for TXNL4A Gene

genes like me logo Genes that share paralogs with TXNL4A: view

Variants for TXNL4A Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Sequence variations from dbSNP and Humsavar for TXNL4A Gene

SNP ID Clin Chr 18 pos Variation AA Info Type
rs535089924 pathogenic, Burn-McKeown syndrome 79,988,581(-) CGCCGTGCGTGCTGACGGCATGCGCGCGCGCTAGCGCCGTGCGTGCTGACGGCATG/CGCCGTGCGTGCTGACGGCATG 5_prime_UTR_variant, genic_upstream_transcript_variant, intron_variant, non_coding_transcript_variant, upstream_transcript_variant
rs727502793 pathogenic, Burn-McKeown syndrome 79,973,765(-) C/A/T coding_sequence_variant, missense_variant, non_coding_transcript_variant, stop_gained
rs727502794 pathogenic, Burn-McKeown syndrome 79,988,356(-) G/A 5_prime_UTR_variant, coding_sequence_variant, intron_variant, non_coding_transcript_variant, stop_gained
rs727502795 pathogenic, Burn-McKeown syndrome 79,988,262(-) A/ 5_prime_UTR_variant, coding_sequence_variant, frameshift, intron_variant, non_coding_transcript_variant, splice_donor_variant
rs786205699 pathogenic, Burn-McKeown syndrome 79,988,604(-) GCGCGCGCTAGCGCCGTGCGTGCTGACGGCATGTGCG/GCG genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for TXNL4A Gene

Variant ID Type Subtype PubMed ID
dgv3412n100 CNV gain 25217958
esv3643326 CNV loss 21293372
nsv1060141 CNV gain 25217958
nsv1061450 CNV gain 25217958
nsv1065902 CNV gain 25217958
nsv428359 CNV gain 18775914
nsv470437 CNV loss 18288195
nsv577953 CNV loss 21841781
nsv577958 CNV gain 21841781

Variation tolerance for TXNL4A Gene

Residual Variation Intolerance Score: 43.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.13; 2.91% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for TXNL4A Gene

Human Gene Mutation Database (HGMD)
TXNL4A
SNPedia medical, phenotypic, and genealogical associations of SNPs for
TXNL4A

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TXNL4A Gene

Disorders for TXNL4A Gene

MalaCards: The human disease database

(6) MalaCards diseases for TXNL4A Gene - From: HGMD, OMIM, ClinVar, GTR, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards

UniProtKB/Swiss-Prot

TXN4A_HUMAN
  • Burn-McKeown syndrome (BMKS) [MIM:608572]: A disease characterized by choanal atresia, sensorineural deafness, cardiac defects, and typical craniofacial dysmorphism consisting of narrow palpebral fissures, coloboma of the lower eyelids, prominent nose with high nasal bridge, short philtrum, cleft lip and/or palate, and large and protruding ears. Intellectual development is normal. {ECO:0000269 PubMed:25434003}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for TXNL4A

ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with TXNL4A: view

No data available for Genatlas for TXNL4A Gene

Publications for TXNL4A Gene

  1. Identification, characterization and crystal structure analysis of the human spliceosomal U5 snRNP-specific 15 kD protein. (PMID: 10610776) Reuter K … Ficner R (Journal of molecular biology 1999) 3 4 22 58
  2. The evolutionarily conserved Dim1 protein defines a novel branch of the thioredoxin fold superfamily. (PMID: 11015569) Zhang YZ … Golemis EA (Physiological genomics 1999) 2 3 4 58
  3. Mutations in the PQBP1 gene prevent its interaction with the spliceosomal protein U5-15 kD. (PMID: 24781215) Mizuguchi M … Okazawa H (Nature communications 2014) 3 4 58
  4. Compound heterozygosity of low-frequency promoter deletions and rare loss-of-function mutations in TXNL4A causes Burn-McKeown syndrome. (PMID: 25434003) Wieczorek D … Strom TM (American journal of human genetics 2014) 3 4 58
  5. Interactions of ErbB4 and Kap1 connect the growth factor and DNA damage response pathways. (PMID: 20858735) Gilmore-Hebert M … Stern DF (Molecular cancer research : MCR 2010) 3 4 58

Products for TXNL4A Gene

Sources for TXNL4A Gene

Content
Loading form....