Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TUSC7 Gene

Subcategory (RNA class) for TUSC7 Gene

non-coding RNA

Quality Score for this RNA gene is


Aliases for TUSC7 Gene

  • Tumor Suppressor Candidate 7 (Non-Protein Coding) 2 3 5
  • LSAMP Antisense RNA 3 (Non-Protein Coding) 3
  • Non-Protein Coding RNA 295 2
  • LSAMP Antisense RNA 3 2
  • NCRNA00295 3
  • LINC00902 3
  • LSAMP-AS1 3
  • LSAMP-AS3 3
  • LSAMPAS3 3

External Ids for TUSC7 Gene

Previous HGNC Symbols for TUSC7 Gene

  • NCRNA00295

Previous GeneCards Identifiers for TUSC7 Gene

  • GC03P116432

Summaries for TUSC7 Gene

GeneCards Summary for TUSC7 Gene

TUSC7 (Tumor Suppressor Candidate 7 (Non-Protein Coding)) is an RNA Gene, and is affiliated with the non-coding RNA class.

Additional gene information for TUSC7 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TUSC7 Gene

Genomics for TUSC7 Gene

Genomic Locations for TUSC7 Gene

Genomic Locations for TUSC7 Gene
14,347 bases
Plus strand

Genomic View for TUSC7 Gene

Genes around TUSC7 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TUSC7 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TUSC7 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TUSC7 Gene

No data available for GeneHancer (GH) Regulatory Elements for TUSC7 Gene

Proteins for TUSC7 Gene

Post-translational modifications for TUSC7 Gene

No Post-translational modifications

No data available for DME Specific Peptides for TUSC7 Gene

Domains & Families for TUSC7 Gene

Gene Families for TUSC7 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with TUSC7: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for TUSC7 Gene

Function for TUSC7 Gene

Phenotypes From GWAS Catalog for TUSC7 Gene

Phenotypes for TUSC7 Gene

GenomeRNAi human phenotypes for TUSC7:
genes like me logo Genes that share phenotypes with TUSC7: view

Animal Model Products

miRNA for TUSC7 Gene

miRTarBase miRNAs that target TUSC7

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for TUSC7 Gene

Localization for TUSC7 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for TUSC7 Gene

Pathways & Interactions for TUSC7 Gene

SuperPathways for TUSC7 Gene

No Data Available

Interacting Proteins for TUSC7 Gene

Gene Ontology (GO) - Biological Process for TUSC7 Gene


No data available for Pathways by source and SIGNOR curated interactions for TUSC7 Gene

Drugs & Compounds for TUSC7 Gene

No Compound Related Data Available

Transcripts for TUSC7 Gene

mRNA/cDNA for TUSC7 Gene

(9) Selected AceView cDNA sequences:
(7) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for TUSC7 Gene

No ASD Table

Relevant External Links for TUSC7 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for TUSC7 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TUSC7 Gene

mRNA differential expression in normal tissues according to GTEx for TUSC7 Gene

This gene is overexpressed in Testis (x50.8).

NURSA nuclear receptor signaling pathways regulating expression of TUSC7 Gene:

genes like me logo Genes that share expression patterns with TUSC7: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for TUSC7 Gene

Orthologs for TUSC7 Gene

Evolution for TUSC7 Gene

Gene Tree for TUSC7 (if available)
Gene Tree for TUSC7 (if available)

No data available for Orthologs for TUSC7 Gene

Paralogs for TUSC7 Gene

No data available for Paralogs for TUSC7 Gene

Variants for TUSC7 Gene

Sequence variations from dbSNP and Humsavar for TUSC7 Gene

SNP ID Clin Chr 03 pos Variation AA Info Type
rs1000526936 -- 116,716,111(+) T/C intron_variant
rs1001023843 -- 116,712,845(+) C/T non_coding_transcript_variant
rs1001214052 -- 116,715,934(+) A/G intron_variant
rs1002061865 -- 116,710,919(+) CATTAACAAACTGCATTAACAAA/CATTAACAAA intron_variant
rs1002203675 -- 116,711,580(+) C/A intron_variant

Structural Variations from Database of Genomic Variants (DGV) for TUSC7 Gene

Variant ID Type Subtype PubMed ID
nsv829686 CNV gain 17160897
nsv1011135 CNV gain 25217958
esv3893770 CNV gain 25118596
dgv295n21 CNV loss 19592680

Additional Variant Information for TUSC7 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for TUSC7 Gene

Disorders for TUSC7 Gene

Additional Disease Information for TUSC7

No disorders were found for TUSC7 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for TUSC7 Gene

Publications for TUSC7 Gene

  1. The Novel Long Noncoding RNA TUSC7 Inhibits Proliferation by Sponging MiR-211 in Colorectal Cancer. (PMID: 28214867) Xu J … Zhao J (Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology 2017) 2 3 58
  2. Low expression of LOC285194 is associated with poor prognosis in colorectal cancer. (PMID: 23680400) Qi P … Du X (Journal of translational medicine 2013) 2 3 58
  3. Recurrent focal copy-number changes and loss of heterozygosity implicate two noncoding RNAs and one tumor suppressor gene at chromosome 3q13.31 in osteosarcoma. (PMID: 20048075) Pasic I … Malkin D (Cancer research 2010) 2 3 58
  4. Long non-coding RNA tumor suppressor candidate 7 advances chemotherapy sensitivity of endometrial carcinoma through targeted silencing of miR-23b. (PMID: 28653877) Shang C … Meng L (Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine 2017) 3 58
  5. Long Non-coding RNA TUSC7, a Target of miR-23b, Plays Tumor-Suppressing Roles in Human Gliomas. (PMID: 27766072) Shang C … Xue YX (Frontiers in cellular neuroscience 2016) 3 58

Products for TUSC7 Gene

Sources for TUSC7 Gene

Loading form....