Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TSPAN1 Gene

Aliases for TSPAN1 Gene

  • Tetraspanin 1 2 3 5
  • Tetraspanin TM4-C 4
  • Tetraspan NET-1 4
  • Tetraspanin-1 3
  • Tetraspan 1 3
  • Tspan-1 4
  • TM4SF 3
  • NET1 3
  • TM4C 3

External Ids for TSPAN1 Gene

Previous GeneCards Identifiers for TSPAN1 Gene

  • GC01P046360
  • GC01P046640
  • GC01P044755

Summaries for TSPAN1 Gene

Entrez Gene Summary for TSPAN1 Gene

  • The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. [provided by RefSeq, Jul 2008]

GeneCards Summary for TSPAN1 Gene

TSPAN1 (Tetraspanin 1) is a Protein Coding gene. An important paralog of this gene is TSPAN18.

Additional gene information for TSPAN1 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TSPAN1 Gene

Genomics for TSPAN1 Gene

GeneHancer (GH) Regulatory Elements for TSPAN1 Gene

Promoters and enhancers for TSPAN1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH01I046170 Promoter/Enhancer 2.1 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 550.8 -1.7 -1745 5 HDGF PKNOX1 CLOCK ATF1 SMAD1 SIN3A GLIS2 ATF7 YY2 NCOA1 TSPAN1 NASP LRRC41 TOE1 NSUN4 MUTYH TEX38 LURAP1 RPL7AP16 RPS15AP10
GH01I046178 Promoter/Enhancer 2 EPDnew Ensembl ENCODE dbSUPER 550.4 +7.4 7412 7 HDGF PKNOX1 CLOCK FOXA2 ARNT ARID4B FEZF1 DMAP1 YBX1 ZNF2 TSPAN1 GPBP1L1 TOE1 RPL7AP16 LRRC41 EFCAB14-AS1 LURAP1 RPS15AP10 TMEM69 CCDC163
GH01I046176 Promoter 0.6 EPDnew 550.8 +1.4 1435 0.1 PRDM10 PIK3R3 LOC105378695 LOC110117498 LOC110117498-PIK3R3 TSPAN1 LURAP1
GH01I046196 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 11.5 +23.2 23173 2.8 HDGF ARNT SIN3A DMAP1 ZNF48 TCF12 POLR2B ZNF143 ATF7 RUNX3 POMGNT1 LURAP1 TOE1 GPBP1L1 LRRC41 PIK3R3 TSPAN1 LOC110117498 RAD54L RPL7AP16
GH01I046129 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 11.2 -42.1 -42120 6.3 CLOCK MLX ZFP64 FEZF1 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 PIK3R3 LOC101929626 TOE1 GPBP1L1 LRRC41 RPL7AP16 EFCAB14-AS1 RPS15AP10 MOB3C TMEM69
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around TSPAN1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the TSPAN1 gene promoter:

Genomic Locations for TSPAN1 Gene

Genomic Locations for TSPAN1 Gene
chr1:46,175,073-46,196,489
(GRCh38/hg38)
Size:
21,417 bases
Orientation:
Plus strand
chr1:46,640,745-46,651,634
(GRCh37/hg19)

Genomic View for TSPAN1 Gene

Genes around TSPAN1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TSPAN1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TSPAN1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TSPAN1 Gene

Proteins for TSPAN1 Gene

  • Protein details for TSPAN1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O60635-TSN1_HUMAN
    Recommended name:
    Tetraspanin-1
    Protein Accession:
    O60635
    Secondary Accessions:
    • D3DQ14
    • O60745
    • Q5VST0

    Protein attributes for TSPAN1 Gene

    Size:
    241 amino acids
    Molecular mass:
    26301 Da
    Quaternary structure:
    No Data Available

neXtProt entry for TSPAN1 Gene

Post-translational modifications for TSPAN1 Gene

  • Glycosylation at isoforms=141, isoforms=154, posLast=178178, and isoforms=184
  • Modification sites at PhosphoSitePlus

Other Protein References for TSPAN1 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • Abcam antibodies for TSPAN1
  • Santa Cruz Biotechnology (SCBT) Antibodies for TSPAN1

No data available for DME Specific Peptides for TSPAN1 Gene

Domains & Families for TSPAN1 Gene

Gene Families for TSPAN1 Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted membrane proteins

Suggested Antigen Peptide Sequences for TSPAN1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

O60635

UniProtKB/Swiss-Prot:

TSN1_HUMAN :
  • Belongs to the tetraspanin (TM4SF) family.
Family:
  • Belongs to the tetraspanin (TM4SF) family.
genes like me logo Genes that share domains with TSPAN1: view

Function for TSPAN1 Gene

Phenotypes From GWAS Catalog for TSPAN1 Gene

Gene Ontology (GO) - Molecular Function for TSPAN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 21836059
genes like me logo Genes that share ontologies with TSPAN1: view
genes like me logo Genes that share phenotypes with TSPAN1: view

Animal Model Products

  • Taconic Biosciences Mouse Models for TSPAN1

CRISPR Products

Inhibitory RNA Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for TSPAN1 Gene

Localization for TSPAN1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for TSPAN1 Gene

Lysosome membrane; Multi-pass membrane protein.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TSPAN1 gene
Compartment Confidence
plasma membrane 5
extracellular 5
nucleus 4
lysosome 3

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nucleoplasm (2)
  • Vesicles (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for TSPAN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005654 nucleoplasm IDA --
GO:0005737 cytoplasm IDA 12115476
GO:0005764 lysosome IEA --
GO:0005765 lysosomal membrane IEA --
GO:0005886 plasma membrane IDA 21836059
genes like me logo Genes that share ontologies with TSPAN1: view

Pathways & Interactions for TSPAN1 Gene

SuperPathways for TSPAN1 Gene

No Data Available

Interacting Proteins for TSPAN1 Gene

STRING Interaction Network Preview (showing 5 interactants - click image to see 6)
http://version10.5.string-db.org/api/image/networkList?limit=0&targetmode=proteins&caller_identity=gene_cards&network_flavor=evidence&identifiers=9606.ENSP00000361072%0d%0a9606.ENSP00000352852%0d%0a9606.ENSP00000316664%0d%0a9606.ENSP00000216211%0d%0a9606.ENSP00000330825%0d%0a9606.ENSP00000303351%0d%0a
Selected Interacting proteins: O60635-TSN1_HUMAN ENSP00000361072 for TSPAN1 Gene via IID STRING

Gene Ontology (GO) - Biological Process for TSPAN1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007166 cell surface receptor signaling pathway IBA --
GO:0008283 cell proliferation IDA 22378020
GO:0016477 cell migration IMP 22378020
GO:0045807 positive regulation of endocytosis IMP 22378020
GO:0050821 protein stabilization IDA 21836059
genes like me logo Genes that share ontologies with TSPAN1: view

No data available for Pathways by source and SIGNOR curated interactions for TSPAN1 Gene

Drugs & Compounds for TSPAN1 Gene

No Compound Related Data Available

Transcripts for TSPAN1 Gene

Unigene Clusters for TSPAN1 Gene

Tetraspanin 1:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for TSPAN1 Gene

ExUns: 1a · 1b ^ 2a · 2b ^ 3 ^ 4 ^ 5 ^ 6a · 6b ^ 7 ^ 8 ^ 9a · 9b · 9c ^ 10a · 10b · 10c ^ 11a · 11b · 11c · 11d
SP1: - - - -
SP2: - - - - - -
SP3: - - - - - -
SP4: - -
SP5: -
SP6: - - - - - - - - - -
SP7: - - - -
SP8: - -
SP9: - - - -
SP10: -
SP11:

Relevant External Links for TSPAN1 Gene

GeneLoc Exon Structure for
TSPAN1
ECgene alternative splicing isoforms for
TSPAN1

Expression for TSPAN1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TSPAN1 Gene

mRNA differential expression in normal tissues according to GTEx for TSPAN1 Gene

This gene is overexpressed in Colon - Transverse (x17.4) and Kidney - Cortex (x10.6).

Protein differential expression in normal tissues from HIPED for TSPAN1 Gene

This gene is overexpressed in Urine (35.9) and Cervix (22.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for TSPAN1 Gene



Protein tissue co-expression partners for TSPAN1 Gene

NURSA nuclear receptor signaling pathways regulating expression of TSPAN1 Gene:

TSPAN1

SOURCE GeneReport for Unigene cluster for TSPAN1 Gene:

Hs.38972

Evidence on tissue expression from TISSUES for TSPAN1 Gene

  • Intestine(4.9)
  • Stomach(2.2)
  • Kidney(2.1)
genes like me logo Genes that share expression patterns with TSPAN1: view

No data available for mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for TSPAN1 Gene

Orthologs for TSPAN1 Gene

This gene was present in the common ancestor of animals.

Orthologs for TSPAN1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia TSPAN1 33 34
  • 99.72 (n)
cow
(Bos Taurus)
Mammalia TSPAN1 33 34
  • 86.31 (n)
dog
(Canis familiaris)
Mammalia TSPAN1 33 34
  • 84.92 (n)
mouse
(Mus musculus)
Mammalia Tspan1 33 16 34
  • 80.56 (n)
rat
(Rattus norvegicus)
Mammalia Tspan1 33
  • 79.53 (n)
oppossum
(Monodelphis domestica)
Mammalia TSPAN1 34
  • 65 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia TSPAN1 34
  • 47 (a)
OneToOne
chicken
(Gallus gallus)
Aves TSPAN1 33 34
  • 66.38 (n)
lizard
(Anolis carolinensis)
Reptilia TSPAN1 34
  • 58 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia tspan1 33
  • 62.34 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.24793 33
zebrafish
(Danio rerio)
Actinopterygii zgc:64085 33
  • 58.63 (n)
TSPAN1 34
  • 47 (a)
OneToOne
-- 33
fruit fly
(Drosophila melanogaster)
Insecta Tsp66E 34
  • 23 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea tsp-11 34
  • 19 (a)
ManyToMany
tsp-13 34
  • 12 (a)
ManyToMany
sea squirt
(Ciona savignyi)
Ascidiacea CSA.10827 34
  • 35 (a)
ManyToMany
CSA.5127 34
  • 33 (a)
ManyToMany
CSA.8143 34
  • 33 (a)
ManyToMany
-- 34
  • 27 (a)
ManyToMany
Species where no ortholog for TSPAN1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for TSPAN1 Gene

ENSEMBL:
Gene Tree for TSPAN1 (if available)
TreeFam:
Gene Tree for TSPAN1 (if available)

Paralogs for TSPAN1 Gene

Paralogs for TSPAN1 Gene

(12) SIMAP similar genes for TSPAN1 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with TSPAN1: view

Variants for TSPAN1 Gene

Sequence variations from dbSNP and Humsavar for TSPAN1 Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
rs1057516318 likely-pathogenic, Muscle eye brain disease 46,194,272(+) A/G genic_downstream_transcript_variant, intron_variant
rs1057516409 likely-pathogenic, Muscle eye brain disease 46,192,499(+) CCTGGTCATTCCAGCCTACCTGGTCATTCCAG/CCTGGTCATTCCAG genic_downstream_transcript_variant, intron_variant
rs1057516477 likely-pathogenic, Muscle eye brain disease 46,196,850(+) C/A downstream_transcript_variant
rs1057516536 likely-pathogenic, Muscle eye brain disease 46,193,389(+) CT/ genic_downstream_transcript_variant, intron_variant
rs1057516576 likely-pathogenic, Muscle eye brain disease 46,192,096(+) ACGT/ genic_downstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for TSPAN1 Gene

Variant ID Type Subtype PubMed ID
esv2761743 CNV gain 21179565
nsv527878 CNV gain 19592680
nsv822520 CNV loss 20364138

Variation tolerance for TSPAN1 Gene

Residual Variation Intolerance Score: 68.2% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.22; 24.44% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for TSPAN1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
TSPAN1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TSPAN1 Gene

Disorders for TSPAN1 Gene

Additional Disease Information for TSPAN1

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology

No disorders were found for TSPAN1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for TSPAN1 Gene

Publications for TSPAN1 Gene

  1. Sequences and expression of six new members of the tetraspanin/TM4SF family. (PMID: 9714763) Todd SC … Levy S (Biochimica et biophysica acta 1998) 2 3 4 58
  2. Risk prediction of prevalent diabetes in a Swiss population using a weighted genetic score--the CoLaus Study. (PMID: 19139842) Lin X … Mooser V (Diabetologia 2009) 3 44 58
  3. Glycosylation of tetraspanin Tspan-1 at four distinct sites promotes its transition through the endoplasmic reticulum. (PMID: 19508227) Scholz CJ … Deissler H (Protein and peptide letters 2009) 3 4 58
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
  5. Sequence and expression of seven new tetraspans. (PMID: 10719184) Serru V … Rubinstein E (Biochimica et biophysica acta 2000) 2 3 58

Products for TSPAN1 Gene

Sources for TSPAN1 Gene

Content
Loading form....