Aliases for TSPAN1 Gene
Aliases for TSPAN1 Gene
External Ids for TSPAN1 Gene
- HGNC: 20657
- Entrez Gene: 10103
- Ensembl: ENSG00000117472
- OMIM: 613170
- UniProtKB: O60635
Previous GeneCards Identifiers for TSPAN1 Gene
- GC01P046360
- GC01P046640
- GC01P044755
Summaries for TSPAN1 Gene
-
The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. [provided by RefSeq, Jul 2008]
GeneCards Summary for TSPAN1 Gene
TSPAN1 (Tetraspanin 1) is a Protein Coding gene. An important paralog of this gene is TSPAN18.
Additional gene information for TSPAN1 Gene
No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TSPAN1 Gene
Genomics for TSPAN1 Gene
GeneHancer (GH) Regulatory Elements for TSPAN1 Gene
Promoters and enhancers for TSPAN1 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data dump
GeneHancers around TSPAN1 on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the TSPAN1 gene promoter:
Regulatory Element Products
Genomic Locations for TSPAN1 Gene
Genomic Locations for TSPAN1 Gene
- chr1:46,175,073-46,196,489
- (GRCh38/hg38)
- Size:
- 21,417 bases
- Orientation:
- Plus strand
- chr1:46,640,745-46,651,634
- (GRCh37/hg19)
Genomic View for TSPAN1 Gene
Genes around TSPAN1 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 1p34.1 by Ensembl
- 1p34.1 by Entrez Gene
- 1p34.1 by HGNC
TSPAN1 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for TSPAN1 Gene
Proteins for TSPAN1 Gene
-
Protein details for TSPAN1 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- O60635-TSN1_HUMAN
- Recommended name:
- Tetraspanin-1
- Protein Accession:
- O60635
- D3DQ14
- O60745
- Q5VST0
Protein attributes for TSPAN1 Gene
- Size:
- 241 amino acids
- Molecular mass:
- 26301 Da
- Quaternary structure:
- No Data Available
Protein Expression for TSPAN1 Gene
Post-translational modifications for TSPAN1 Gene
Other Protein References for TSPAN1 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- R&D Systems Antibodies for TSPAN1 (TSPAN1)
-
Custom Antibody ServicesOriGene Antibodies for TSPAN1
- Novus Biologicals Antibodies for TSPAN1
-
Abcam antibodies for TSPAN1
-
Cloud-Clone Corp. Antibodies for TSPAN1
- Invitrogen Antibodies for TSPAN1
- GeneTex TSPAN1 antibody for TSPAN1
-
Santa Cruz Biotechnology (SCBT) Antibodies for TSPAN1
- Sino Biological Antibodies for TSPAN1
Protein Products
-
OriGene Purified Proteins for TSPAN1
- Search Origene for MassSpec and Protein Over-expression Lysates for TSPAN1
- Origene Custom Protein Services for TSPAN1
- Sino Biological Recombinant Proteins for TSPAN1
- Sino Biological Cell Lysates for TSPAN1
-
Cloud-Clone Corp. Proteins for TSPAN1
- antibodies-online: Search results for 9 available TSPAN1 Proteins ranked by validation data
- Compare Top TSPAN1 Proteins
-
Quality Products:
- Search GeneTex for Proteins for TSPAN1
-
Abcam proteins for TSPAN1
Assay Products
-
Cloud-Clone Corp. Assay Kits for TSPAN1
- antibodies-online: Search results for 4 available TSPAN1 Elisa Kits ranked by validation data
- Compare Top TSPAN1 Elisa Kits
-
Quality Products:
No data available for DME Specific Peptides for TSPAN1 Gene
Domains & Families for TSPAN1 Gene
Gene Families for TSPAN1 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Predicted membrane proteins
Protein Domains for TSPAN1 Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for TSPAN1 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
O60635- Family:
-
- Belongs to the tetraspanin (TM4SF) family.
Function for TSPAN1 Gene
Phenotypes From GWAS Catalog for TSPAN1 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005515 | protein binding | IPI | 21836059 |
Phenotypes for TSPAN1 Gene
- GenomeRNAi human phenotypes for TSPAN1:
Animal Model Products
-
Taconic Biosciences Mouse Models for TSPAN1
- Cyagen custom Knockout/knockin (KOKI) mouse models for TSPAN1
-
-
ViGene Biosciences lentiviral particle packaged cDNA for TSPAN1 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for TSPAN1 gene
- Search ViGene Biosciences for TSPAN1
CRISPR Products
-
OriGene CRISPR knockouts for TSPAN1
- genomics-online: gRNA clones - Search results for available TSPAN1 gene related products
- Applied Biological Materials CRISPR for TSPAN1
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for TSPAN1
- GenScript: Design CRISPR guide RNA sequences for TSPAN1
miRNA for TSPAN1 Gene
- miRTarBase miRNAs that target TSPAN1
-
- hsa-mir-573 (MIRT438319)
- hsa-mir-31-5p (MIRT472350)
- hsa-mir-4313 (MIRT472351)
- hsa-mir-6793-3p (MIRT472352)
- hsa-mir-4673 (MIRT472353)
- hsa-mir-4645-5p (MIRT472354)
- hsa-mir-103b (MIRT472355)
- hsa-mir-4742-5p (MIRT472356)
- hsa-mir-4733-3p (MIRT472357)
- hsa-mir-7853-5p (MIRT472358)
- hsa-mir-105-5p (MIRT472359)
- hsa-mir-449b-3p (MIRT472360)
- hsa-mir-1911-3p (MIRT472361)
- hsa-mir-365b-3p (MIRT472362)
- hsa-mir-3915 (MIRT472363)
- hsa-mir-365a-3p (MIRT472364)
- hsa-mir-4736 (MIRT472365)
- hsa-mir-657 (MIRT472366)
- hsa-mir-3928-3p (MIRT472367)
- hsa-mir-4495 (MIRT472368)
- hsa-mir-1252-3p (MIRT472369)
- hsa-mir-3646 (MIRT472370)
- hsa-mir-3662 (MIRT472371)
- hsa-mir-613 (MIRT472372)
- hsa-mir-206 (MIRT472373)
- hsa-mir-1-3p (MIRT472374)
- hsa-mir-3941 (MIRT612727)
- hsa-mir-153-5p (MIRT612728)
- hsa-mir-4789-3p (MIRT612729)
- hsa-mir-603 (MIRT612730)
- hsa-mir-8485 (MIRT612731)
- hsa-mir-362-3p (MIRT612732)
- hsa-mir-329-3p (MIRT612733)
- hsa-mir-4789-5p (MIRT616947)
- hsa-mir-34a-3p (MIRT627978)
- hsa-mir-607 (MIRT639491)
- hsa-mir-6749-3p (MIRT639492)
- hsa-mir-660-3p (MIRT639493)
- hsa-mir-5193 (MIRT639494)
- hsa-mir-483-3p (MIRT639495)
- hsa-mir-1277-5p (MIRT655886)
- hsa-mir-5011-5p (MIRT655887)
- hsa-mir-190a-3p (MIRT675943)
- hsa-mir-548c-3p (MIRT708018)
- hsa-mir-584-5p (MIRT722952)
- hsa-mir-8068 (MIRT722953)
- hsa-mir-5087 (MIRT722954)
- hsa-mir-6830-5p (MIRT722955)
- hsa-mir-758-5p (MIRT722956)
- hsa-mir-218-2-3p (MIRT722957)
- hsa-mir-651-3p (MIRT722958)
miRNA Products
- Search ViGene Biosciences for TSPAN1
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for TSPAN1
- Browse OriGene Inhibitory RNA Products For TSPAN1
- genomics-online: shRNA clones - Search results for available TSPAN1 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for TSPAN1 gene
Clone Products
- Sino Biological Human cDNA Clone for TSPAN1
- VectorBuilder custom plasmid, inducible vectors for TSPAN1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for TSPAN1
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- genomics-online: cdna clones - Search results for available TSPAN1 gene related products
- orf clones - Search results for available TSPAN1 gene related products
- Applied Biological Materials Clones for TSPAN1
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
- R&D Systems cDNA Clones for TSPAN1
Cell Line Products
-
Horizon Cell Lines for TSPAN1
-
ViGene Biosciences adenoviral particle packaged cDNA for TSPAN1 gene
-
ViGene Biosciences lentiviral particle packaged cDNA for TSPAN1 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for TSPAN1 gene
No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for TSPAN1 Gene
Localization for TSPAN1 Gene
Subcellular locations from UniProtKB/Swiss-Prot for TSPAN1 Gene
- Lysosome membrane; Multi-pass membrane protein.
| Compartment | Confidence |
|---|---|
| plasma membrane | 5 |
| extracellular | 5 |
| nucleus | 4 |
| lysosome | 3 |
- Nucleoplasm (2)
- Vesicles (2)
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005654 | nucleoplasm | IDA | -- |
| GO:0005737 | cytoplasm | IDA | 12115476 |
| GO:0005764 | lysosome | IEA | -- |
| GO:0005765 | lysosomal membrane | IEA | -- |
| GO:0005886 | plasma membrane | IDA | 21836059 |
Pathways & Interactions for TSPAN1 Gene
No Data Available
Interacting Proteins for TSPAN1 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0007166 | cell surface receptor signaling pathway | IBA | -- |
| GO:0008283 | cell proliferation | IDA | 22378020 |
| GO:0016477 | cell migration | IMP | 22378020 |
| GO:0045807 | positive regulation of endocytosis | IMP | 22378020 |
| GO:0050821 | protein stabilization | IDA | 21836059 |
No data available for Pathways by source and SIGNOR curated interactions for TSPAN1 Gene
Transcripts for TSPAN1 Gene
mRNA/cDNA for TSPAN1 Gene
- (2) REFSEQ mRNAs :
- (7) Additional mRNA sequences :
- (390) Selected AceView cDNA sequences:
- (9) Ensembl transcripts including schematic representations, and UCSC links where relevant :
CRISPR Products
-
OriGene CRISPR knockouts for TSPAN1
- genomics-online: gRNA clones - Search results for available TSPAN1 gene related products
- Applied Biological Materials CRISPR for TSPAN1
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for TSPAN1
- GenScript: Design CRISPR guide RNA sequences for TSPAN1
miRNA Products
- Search ViGene Biosciences for TSPAN1
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for TSPAN1
- Browse OriGene Inhibitory RNA Products For TSPAN1
- genomics-online: shRNA clones - Search results for available TSPAN1 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for TSPAN1 gene
Clone Products
- Sino Biological Human cDNA Clone for TSPAN1
- VectorBuilder custom plasmid, inducible vectors for TSPAN1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for TSPAN1
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- genomics-online: cdna clones - Search results for available TSPAN1 gene related products
- orf clones - Search results for available TSPAN1 gene related products
- Applied Biological Materials Clones for TSPAN1
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
- R&D Systems cDNA Clones for TSPAN1
| ExUns: | 1a | · | 1b | ^ | 2a | · | 2b | ^ | 3 | ^ | 4 | ^ | 5 | ^ | 6a | · | 6b | ^ | 7 | ^ | 8 | ^ | 9a | · | 9b | · | 9c | ^ | 10a | · | 10b | · | 10c | ^ | 11a | · | 11b | · | 11c | · | 11d |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | - | - | - | - | |||||||||||||||||||||||||||||||||||||
| SP2: | - | - | - | - | - | - | |||||||||||||||||||||||||||||||||||
| SP3: | - | - | - | - | - | - | |||||||||||||||||||||||||||||||||||
| SP4: | - | - | |||||||||||||||||||||||||||||||||||||||
| SP5: | - | ||||||||||||||||||||||||||||||||||||||||
| SP6: | - | - | - | - | - | - | - | - | - | - | |||||||||||||||||||||||||||||||
| SP7: | - | - | - | - | |||||||||||||||||||||||||||||||||||||
| SP8: | - | - | |||||||||||||||||||||||||||||||||||||||
| SP9: | - | - | - | - | |||||||||||||||||||||||||||||||||||||
| SP10: | - | ||||||||||||||||||||||||||||||||||||||||
| SP11: |
Expression for TSPAN1 Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
- Bone (Muscoskeletal System)
- Kidney (Urinary System)
- Cartilage (Muscoskeletal System)
- Inner Cell Mass (Early Embryonic Tissues)
- Adipose (Muscoskeletal System)
- Epithelial Cells (Uncategorized)
- Liver (Hepatobiliary System)
-
Colon (Gastrointestinal Tract)
-
Prostate (Endocrine System)
-
Thyroid (Endocrine System)
-
Stomach (Gastrointestinal Tract)
mRNA differential expression in normal tissues according to GTEx for TSPAN1 Gene
This gene is overexpressed in Colon - Transverse (x17.4) and Kidney - Cortex (x10.6).
This gene is overexpressed in Urine (35.9) and Cervix (22.2).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for TSPAN1 Gene
NURSA nuclear receptor signaling pathways regulating expression of TSPAN1 Gene:
TSPAN1SOURCE GeneReport for Unigene cluster for TSPAN1 Gene:
Hs.38972Evidence on tissue expression from TISSUES for TSPAN1 Gene
- Intestine(4.9)
- Stomach(2.2)
- Kidney(2.1)
Primer Products
-
OriGene qPCR primer pairs for TSPAN1
-
OriGene qPCR primer pairs and template standards for TSPAN1
- genomics-online: primer clones - Search results for available TSPAN1 gene related products
Gene Expression Assay Products
No data available for mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for TSPAN1 Gene
Orthologs for TSPAN1 Gene
This gene was present in the common ancestor of animals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | TSPAN1 33 34 |
|
||
| cow (Bos Taurus) |
Mammalia | TSPAN1 33 34 |
|
||
| dog (Canis familiaris) |
Mammalia | TSPAN1 33 34 |
|
||
| mouse (Mus musculus) |
Mammalia | Tspan1 33 16 34 |
|
||
| rat (Rattus norvegicus) |
Mammalia | Tspan1 33 |
|
||
| oppossum (Monodelphis domestica) |
Mammalia | TSPAN1 34 |
|
OneToOne | |
| platypus (Ornithorhynchus anatinus) |
Mammalia | TSPAN1 34 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | TSPAN1 33 34 |
|
||
| lizard (Anolis carolinensis) |
Reptilia | TSPAN1 34 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | tspan1 33 |
|
||
| African clawed frog (Xenopus laevis) |
Amphibia | Xl.24793 33 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | zgc:64085 33 |
|
||
| TSPAN1 34 |
|
OneToOne | |||
| -- 33 |
|
||||
| fruit fly (Drosophila melanogaster) |
Insecta | Tsp66E 34 |
|
OneToMany | |
| worm (Caenorhabditis elegans) |
Secernentea | tsp-11 34 |
|
ManyToMany | |
| tsp-13 34 |
|
ManyToMany | |||
| sea squirt (Ciona savignyi) |
Ascidiacea | CSA.10827 34 |
|
ManyToMany | |
| CSA.5127 34 |
|
ManyToMany | |||
| CSA.8143 34 |
|
ManyToMany | |||
| -- 34 |
|
ManyToMany |
- Species where no ortholog for TSPAN1 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Paralogs for TSPAN1 Gene
Paralogs for TSPAN1 Gene
(12) SIMAP similar genes for TSPAN1 Gene using alignment to 1 proteins:
Variants for TSPAN1 Gene
| SNP ID | Clin | Chr 01 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs1057516318 | likely-pathogenic, Muscle eye brain disease | 46,194,272(+) | A/G | genic_downstream_transcript_variant, intron_variant | |
| rs1057516409 | likely-pathogenic, Muscle eye brain disease | 46,192,499(+) | CCTGGTCATTCCAGCCTACCTGGTCATTCCAG/CCTGGTCATTCCAG | genic_downstream_transcript_variant, intron_variant | |
| rs1057516477 | likely-pathogenic, Muscle eye brain disease | 46,196,850(+) | C/A | downstream_transcript_variant | |
| rs1057516536 | likely-pathogenic, Muscle eye brain disease | 46,193,389(+) | CT/ | genic_downstream_transcript_variant, intron_variant | |
| rs1057516576 | likely-pathogenic, Muscle eye brain disease | 46,192,096(+) | ACGT/ | genic_downstream_transcript_variant, intron_variant |
Residual Variation Intolerance Score:
68.2% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
1.22;
24.44% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for TSPAN1 Gene
- SNPedia medical, phenotypic, and genealogical associations of SNPs for
- TSPAN1
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TSPAN1 Gene
Disorders for TSPAN1 Gene
Additional Disease Information for TSPAN1
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No disorders were found for TSPAN1 Gene.
No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for TSPAN1 Gene
Publications for TSPAN1 Gene
- Sequences and expression of six new members of the tetraspanin/TM4SF family. (PMID: 9714763) Todd SC … Levy S (Biochimica et biophysica acta 1998) 2 3 4 58
- Risk prediction of prevalent diabetes in a Swiss population using a weighted genetic score--the CoLaus Study. (PMID: 19139842) Lin X … Mooser V (Diabetologia 2009) 3 44 58
- Glycosylation of tetraspanin Tspan-1 at four distinct sites promotes its transition through the endoplasmic reticulum. (PMID: 19508227) Scholz CJ … Deissler H (Protein and peptide letters 2009) 3 4 58
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
- Sequence and expression of seven new tetraspans. (PMID: 10719184) Serru V … Rubinstein E (Biochimica et biophysica acta 2000) 2 3 58
Products for TSPAN1 Gene
- R&D Systems Antibodies for TSPAN1 (TSPAN1)
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- R&D Systems cDNA Clones for TSPAN1
- Browse Human Proteins and Enzymes
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for TSPAN1
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for TSPAN1
- Search Origene for MassSpec and Protein Over-expression Lysates for TSPAN1
- Origene Custom Protein Services for TSPAN1
- Origene shrna, sirna, and RNAi products in human, mouse, rat for TSPAN1
- Browse OriGene Inhibitory RNA Products For TSPAN1
- OriGene qPCR primer pairs and template standards for TSPAN1
- OriGene qPCR primer pairs for TSPAN1
- OriGene CRISPR knockouts for TSPAN1
- OriGene ORF clones in human for TSPAN1
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For TSPAN1
- GenScript: Next-day shipping of latest version cDNA ORF clones for TSPAN1 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for TSPAN1
- GenScript Custom Assay Services for TSPAN1
- GenScript Custom overexpressing Cell Line Services for TSPAN1
- GenScript: Design CRISPR guide RNA sequences for TSPAN1
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for TSPAN1
- Sino Biological Human cDNA Clone for TSPAN1
- Sino Biological Cell Lysates for TSPAN1
- Sino Biological Recombinant Proteins for TSPAN1
- Sino Biological Antibodies for TSPAN1
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals Antibodies for TSPAN1
- Novus Biologicals lysates and proteins for TSPAN1
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for TSPAN1
- Abcam proteins for TSPAN1
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Cloud-Clone Corp. Antibodies for TSPAN1
- Cloud-Clone Corp. Proteins for TSPAN1
- Cloud-Clone Corp. Assay Kits for TSPAN1
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Taconic Biosciences Mouse Models for TSPAN1
- Find your next knockout model in the Taconic Knockout Repository
- Genetically Engineered Models Available Immediately
- Humanized Mice
- Invitrogen Antibodies for TSPAN1
- Cyagen custom Knockout/knockin (KOKI) mouse models for TSPAN1
- VectorBuilder custom plasmid, inducible vectors for TSPAN1
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for TSPAN1
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- antibodies-online: Search results for 73 available TSPAN1 Antibodies ranked by validation data
- Compare Top TSPAN1 Antibodies
- antibodies-online: Search results for 4 available TSPAN1 Elisa Kits ranked by validation data
- Compare Top TSPAN1 Elisa Kits
- Quality Products:
- antibodies-online: Search results for 9 available TSPAN1 Proteins ranked by validation data
- Compare Top TSPAN1 Proteins
- Quality Products:
- GeneTex TSPAN1 antibody for TSPAN1
- Search GeneTex for Proteins for TSPAN1
- ViGene Biosciences adenoviral particle packaged cDNA for TSPAN1 gene
- ViGene Biosciences lentiviral particle packaged cDNA for TSPAN1 gene
- ViGene Biosciences ready-to-package AAV shRNAs for TSPAN1 gene
- Search ViGene Biosciences for TSPAN1
- Santa Cruz Biotechnology (SCBT) Antibodies for TSPAN1
- Search Santa Cruz Biotechnology (SCBT) for TSPAN1 siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for TSPAN1
- Horizon Cell Lines for TSPAN1
- genomics-online: cdna clones - Search results for available TSPAN1 gene related products
- orf clones - Search results for available TSPAN1 gene related products
- genomics-online: gRNA clones - Search results for available TSPAN1 gene related products
- genomics-online: primer clones - Search results for available TSPAN1 gene related products
- genomics-online: shRNA clones - Search results for available TSPAN1 gene related products
Sources for TSPAN1 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew
- (158) Applied Biosystems
