This gene encodes an enzyme that hydrolyses trehalose, a disaccharide formed from two glucose molecules found mainly in fungi, plants, and insects. A partial duplication of this gene is located adjacent to this locus on chromosome 11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014] See more...

Aliases for TREH Gene

Aliases for TREH Gene

  • Trehalase 2 3 4 5
  • Alpha,Alpha-Trehalose Glucohydrolase 2 3 4
  • Trehalase (Brush-Border Membrane Glycoprotein) 2 3
  • Alpha,Alpha-Trehalase 2 4
  • EC 3.2.1.28 4 54
  • TREA 3 4
  • TREHD 3
  • TRE 3

External Ids for TREH Gene

Previous GeneCards Identifiers for TREH Gene

  • GC11M120885
  • GC11M120040
  • GC11M118562
  • GC11M118066
  • GC11M118034
  • GC11M118528
  • GC11M114466

Summaries for TREH Gene

Entrez Gene Summary for TREH Gene

  • This gene encodes an enzyme that hydrolyses trehalose, a disaccharide formed from two glucose molecules found mainly in fungi, plants, and insects. A partial duplication of this gene is located adjacent to this locus on chromosome 11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]

GeneCards Summary for TREH Gene

TREH (Trehalase) is a Protein Coding gene. Diseases associated with TREH include Trehalase Deficiency and Lactose Intolerance. Among its related pathways are Galactose metabolism and Digestion of dietary carbohydrate. Gene Ontology (GO) annotations related to this gene include alpha,alpha-trehalase activity.

UniProtKB/Swiss-Prot Summary for TREH Gene

  • Intestinal trehalase is probably involved in the hydrolysis of ingested trehalose.

Additional gene information for TREH Gene

No data available for CIViC Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for TREH Gene

Genomics for TREH Gene

GeneHancer (GH) Regulatory Elements for TREH Gene

Promoters and enhancers for TREH Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around TREH on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the TREH gene promoter:
  • AML1a
  • AREB6
  • Arnt
  • Bach1
  • E47
  • Evi-1
  • Ik-2
  • Olf-1
  • Tal-1beta

Genomic Locations for TREH Gene

Genomic Locations for TREH Gene
chr11:118,657,316-118,679,690
(GRCh38/hg38)
Size:
22,375 bases
Orientation:
Minus strand
chr11:118,528,026-118,550,399
(GRCh37/hg19)
Size:
22,374 bases
Orientation:
Minus strand

Genomic View for TREH Gene

Genes around TREH on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TREH Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TREH Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TREH Gene

Proteins for TREH Gene

  • Protein details for TREH Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O43280-TREA_HUMAN
    Recommended name:
    Trehalase
    Protein Accession:
    O43280
    Secondary Accessions:
    • Q32MB9
    • Q53FY8

    Protein attributes for TREH Gene

    Size:
    583 amino acids
    Molecular mass:
    66568 Da
    Quaternary structure:
    • Homodimer; disulfide-linked.

    Alternative splice isoforms for TREH Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for TREH Gene

Selected DME Specific Peptides for TREH Gene

O43280:
  • GFGWTNG
  • RSQPPLLTLM
  • EFYYWDSYW
  • SGWDFSSRW

Post-translational modifications for TREH Gene

  • Glycosylation at Asn78, Asn239, Asn261, and Asn369
  • Modification sites at PhosphoSitePlus

Other Protein References for TREH Gene

Domains & Families for TREH Gene

Gene Families for TREH Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Enzymes
  • Potential drug targets
  • Predicted secreted proteins

Suggested Antigen Peptide Sequences for TREH Gene

GenScript: Design optimal peptide antigens:
  • Alpha,alpha-trehalose glucohydrolase (TREA_HUMAN)

Graphical View of Domain Structure for InterPro Entry

O43280

UniProtKB/Swiss-Prot:

TREA_HUMAN :
  • Belongs to the glycosyl hydrolase 37 family.
Family:
  • Belongs to the glycosyl hydrolase 37 family.
genes like me logo Genes that share domains with TREH: view

Function for TREH Gene

Molecular function for TREH Gene

UniProtKB/Swiss-Prot Function:
Intestinal trehalase is probably involved in the hydrolysis of ingested trehalose.
UniProtKB/Swiss-Prot CatalyticActivity:
Reaction=alpha,alpha-trehalose + H2O = alpha-D-glucose + beta-D-glucose; Xref=Rhea:RHEA:32675, ChEBI:CHEBI:15377, ChEBI:CHEBI:15903, ChEBI:CHEBI:16551, ChEBI:CHEBI:17925; EC=3.2.1.28; Evidence={ECO:0000269 PubMed:8773341, ECO:0000269 PubMed:9427547};.

Enzyme Numbers (IUBMB) for TREH Gene

Phenotypes From GWAS Catalog for TREH Gene

Gene Ontology (GO) - Molecular Function for TREH Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004555 alpha,alpha-trehalase activity IDA 8773341
GO:0016787 hydrolase activity IEA --
GO:0016798 hydrolase activity, acting on glycosyl bonds IEA --
genes like me logo Genes that share ontologies with TREH: view
genes like me logo Genes that share phenotypes with TREH: view

Human Phenotype Ontology for TREH Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for TREH Gene

MGI Knock Outs for TREH:
  • Treh Treh<tm1Tkam>

Animal Model Products

CRISPR Products

miRNA for TREH Gene

miRTarBase miRNAs that target TREH

Clone Products

No data available for Transcription Factor Targets and HOMER Transcription for TREH Gene

Localization for TREH Gene

Subcellular locations from UniProtKB/Swiss-Prot for TREH Gene

Cell membrane; Lipid-anchor, GPI-anchor.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TREH gene
Compartment Confidence
plasma membrane 5
extracellular 2
endoplasmic reticulum 2
cytosol 1
lysosome 1
peroxisome 0

Gene Ontology (GO) - Cellular Components for TREH Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005886 plasma membrane IEA --
GO:0016020 membrane IEA --
GO:0031225 anchored component of membrane ISS --
GO:0046658 anchored component of plasma membrane TAS 8773341
GO:0070062 extracellular exosome HDA 19056867
genes like me logo Genes that share ontologies with TREH: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for TREH Gene

Pathways & Interactions for TREH Gene

genes like me logo Genes that share pathways with TREH: view

Pathways by source for TREH Gene

1 BioSystems pathway for TREH Gene
2 KEGG pathways for TREH Gene

Gene Ontology (GO) - Biological Process for TREH Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005991 trehalose metabolic process NAS 8773341
GO:0005993 trehalose catabolic process IDA 9427547
GO:0008152 metabolic process IEA --
GO:0009887 animal organ morphogenesis IEA --
genes like me logo Genes that share ontologies with TREH: view

No data available for SIGNOR curated interactions for TREH Gene

Drugs & Compounds for TREH Gene

(11) Drugs for TREH Gene - From: HMDB and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
D-glucose Approved, Investigational, Vet_approved Pharma 0
Water Approved Pharma 0
Beta-D-Glucose Experimental Pharma 0
Uridine diphosphate glucose Experimental Pharma 0
Trehalose Investigational Pharma 0

(7) Additional Compounds for TREH Gene - From: HMDB and Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
Alpha-D-Glucose
  • alpha-D-GLC
  • alpha-Dextrose
  • a-D-GLC
  • α-D-GLC
  • a-D-Glucose
492-62-6
genes like me logo Genes that share compounds with TREH: view

Transcripts for TREH Gene

mRNA/cDNA for TREH Gene

(2) REFSEQ mRNAs :
(7) Additional mRNA sequences :
(16) Selected AceView cDNA sequences:
(5) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for TREH Gene

ExUns: 1a · 1b · 1c · 1d ^ 2 ^ 3 ^ 4a · 4b · 4c ^ 5 ^ 6 ^ 7 ^ 8 ^ 9a · 9b ^ 10 ^ 11a · 11b ^ 12 ^ 13 ^ 14 ^ 15a · 15b · 15c
SP1: - - -
SP2: - - - -
SP3: - - - -
SP4:
SP5: -

Relevant External Links for TREH Gene

GeneLoc Exon Structure for
TREH
ECgene alternative splicing isoforms for
TREH

Expression for TREH Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TREH Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for TREH Gene

This gene is overexpressed in Small Intestine - Terminal Ileum (x19.4) and Kidney - Cortex (x8.6).

Protein differential expression in normal tissues from HIPED for TREH Gene

This gene is overexpressed in Urine (44.3) and Serum (21.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for TREH Gene



Protein tissue co-expression partners for TREH Gene

NURSA nuclear receptor signaling pathways regulating expression of TREH Gene:

TREH

SOURCE GeneReport for Unigene cluster for TREH Gene:

Hs.129712

mRNA Expression by UniProt/SwissProt for TREH Gene:

O43280-TREA_HUMAN
Tissue specificity: Expressed in kidney, liver and small intestine. Also more weakly expressed in pancreas.

Evidence on tissue expression from TISSUES for TREH Gene

  • Kidney(4.4)

Phenotype-based relationships between genes and organs from Gene ORGANizer for TREH Gene

Germ Layers:
  • endoderm
Systems:
  • digestive
Regions:
Abdomen:
  • intestine
  • large intestine
  • small intestine
genes like me logo Genes that share expression patterns with TREH: view

Orthologs for TREH Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for TREH Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia TREH 33 32
  • 99.31 (n)
OneToOne
dog
(Canis familiaris)
Mammalia TREH 33 32
  • 84.79 (n)
OneToOne
cow
(Bos Taurus)
Mammalia TREH 33 32
  • 84.62 (n)
OneToOne
rat
(Rattus norvegicus)
Mammalia Treh 32
  • 83.01 (n)
mouse
(Mus musculus)
Mammalia Treh 17 33 32
  • 82.66 (n)
oppossum
(Monodelphis domestica)
Mammalia TREH 33
  • 66 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia TREH 33
  • 54 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia TREH 33
  • 56 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia treh 32
  • 59.5 (n)
zebrafish
(Danio rerio)
Actinopterygii treh 33 32
  • 60.51 (n)
OneToOne
Dr.14709 32
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.2295 32
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP012053 32
  • 54.81 (n)
fruit fly
(Drosophila melanogaster)
Insecta Treh 33 34 32
  • 54.47 (n)
OneToMany
CG6262 33
  • 19 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea tre-3 33 32
  • 48.69 (n)
OneToMany
tre-1 33
  • 39 (a)
OneToMany
tre-5 33
  • 32 (a)
OneToMany
tre-4 33
  • 32 (a)
OneToMany
tre-2 33
  • 31 (a)
OneToMany
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes NTH1 33
  • 18 (a)
OneToMany
NTH2 35 33
  • 17 (a)
thale cress
(Arabidopsis thaliana)
eudicotyledons TRE1 32
  • 47.12 (n)
rice
(Oryza sativa)
Liliopsida Os10g0521000 32
  • 48.18 (n)
bread mold
(Neurospora crassa)
Ascomycetes NCU00943 32
  • 50 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 33
  • 45 (a)
OneToOne
Species where no ortholog for TREH was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for TREH Gene

ENSEMBL:
Gene Tree for TREH (if available)
TreeFam:
Gene Tree for TREH (if available)
Aminode:
Evolutionary constrained regions (ECRs) for TREH: view image

Paralogs for TREH Gene

Pseudogenes.org Pseudogenes for TREH Gene

genes like me logo Genes that share paralogs with TREH: view

No data available for Paralogs for TREH Gene

Variants for TREH Gene

Sequence variations from dbSNP and Humsavar for TREH Gene

SNP ID Clin Chr 11 pos Variation AA Info Type
rs11827611 likely-benign, not provided, - 118,659,457(-) A/G coding_sequence_variant, missense_variant
rs527655595 pathogenic, alpha, alpha-Trehalase deficiency 118,663,423(-) CGTGGCAGTAAATCTCACTGCAGAGAC/C coding_sequence_variant, intron_variant, splice_acceptor_variant
rs34978247 likely-benign, not provided 118,662,885(-) T/C coding_sequence_variant, missense_variant
rs1000269510 -- 118,657,612(-) T/C 3_prime_UTR_variant
rs1000600962 -- 118,677,182(-) G/A/C intron_variant

Structural Variations from Database of Genomic Variants (DGV) for TREH Gene

Variant ID Type Subtype PubMed ID
dgv234e214 CNV gain 21293372
esv2674547 CNV deletion 23128226
esv2745124 CNV deletion 23290073
nsv832283 CNV loss 17160897

Variation tolerance for TREH Gene

Gene Damage Index Score: 6.88; 79.50% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for TREH Gene

Human Gene Mutation Database (HGMD)
TREH
SNPedia medical, phenotypic, and genealogical associations of SNPs for
TREH

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TREH Gene

Disorders for TREH Gene

MalaCards: The human disease database

(6) MalaCards diseases for TREH Gene - From: HGMD, OMIM, ClinVar, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
trehalase deficiency
  • trehalose intolerance
lactose intolerance
  • lm - lactose malabsorption
diarrhea 5, with tufting enteropathy, congenital
  • diar5
retinitis pigmentosa 49
  • rp49
vulvovaginitis
  • vulvo-vaginitis
- elite association - COSMIC cancer census association via MalaCards
Search TREH in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

TREA_HUMAN
  • Trehalase deficiency (TREHD) [MIM:612119]: An autosomal recessive condition characterized by the inability to digest trehalose, a disaccharide found in mushrooms, products containing baker's yeast, and dried food. Individuals with trehalase deficiency suffer from abdominal pain, increased rectal flatulence, and diarrhea due to osmotic water flow into the colon. {ECO:0000269 PubMed:28406212}. Note=The gene represented in this entry is involved in disease pathogenesis.

Additional Disease Information for TREH

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with TREH: view

No data available for Genatlas for TREH Gene

Publications for TREH Gene

  1. Molecular cloning, sequencing and expression of cDNA encoding human trehalase. (PMID: 9427547) Ishihara R … Kobayashi Y (Gene 1997) 2 3 4 23 56
  2. Human trehalase: characterization, localization, and its increase in urine by renal proximal tubular damage. (PMID: 8773341) Sasai-Takedatsu M … Kobayashi Y (Nephron 1996) 3 4 23 56
  3. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose JE … Uhl GR (Molecular medicine (Cambridge, Mass.) 2010) 3 43 56
  4. Human trehalase is a stress responsive protein in Saccharomyces cerevisiae. (PMID: 19126402) Ouyang Y … Xu Z (Biochemical and biophysical research communications 2009) 3 23 56
  5. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 56

Products for TREH Gene

Sources for TREH Gene