TMEM98 Gene (Protein Coding)

Transmembrane Protein 98

GC17P032927
GIFtS:
40
This gene encodes a transmembrane protein. A missense mutation in this gene result in Nanophthalmos 4 (NNO4). Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2014] See more...

Aliases for TMEM98 Gene

Aliases for TMEM98 Gene

  • Transmembrane Protein 98 2 3 4 5
  • Protein TADA1 4
  • TADA1 3

External Ids for TMEM98 Gene

Previous GeneCards Identifiers for TMEM98 Gene

  • GC17P028280
  • GC17P031254
  • GC17P027440

Summaries for TMEM98 Gene

Entrez Gene Summary for TMEM98 Gene

  • This gene encodes a transmembrane protein. A missense mutation in this gene result in Nanophthalmos 4 (NNO4). Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2014]

GeneCards Summary for TMEM98 Gene

TMEM98 (Transmembrane Protein 98) is a Protein Coding gene. Diseases associated with TMEM98 include Nanophthalmos 4 and Microphthalmia.

UniProtKB/Swiss-Prot Summary for TMEM98 Gene

  • Functions as a negative regulator of MYRF in oligodendrocyte differentiation and myelination. Interacts with the C-terminal of MYRF inhibiting MYRF self-cleavage and N-fragment nuclear translocation. The secreted form promotes differentiation of T helper 1 cells (Th1).

Gene Wiki entry for TMEM98 Gene

Additional gene information for TMEM98 Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for TMEM98 Gene

Genomics for TMEM98 Gene

GeneHancer (GH) Regulatory Elements for TMEM98 Gene

Promoters and enhancers for TMEM98 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around TMEM98 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the TMEM98 gene promoter:
  • AML1a
  • ATF6
  • C/EBPalpha
  • GCNF
  • GCNF-1
  • GCNF-2
  • HNF-4alpha1
  • Pax-4a
  • RFX1
  • YY1

Genomic Locations for TMEM98 Gene

Genomic Locations for TMEM98 Gene
chr17:32,927,910-32,945,106
(GRCh38/hg38)
Size:
17,197 bases
Orientation:
Plus strand
chr17:31,254,928-31,272,124
(GRCh37/hg19)
Size:
17,197 bases
Orientation:
Plus strand

Genomic View for TMEM98 Gene

Genes around TMEM98 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TMEM98 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TMEM98 Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for TMEM98 Gene

Proteins for TMEM98 Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for TMEM98 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9Y2Y6-TMM98_HUMAN
    Recommended name:
    Transmembrane protein 98
    Protein Accession:
    Q9Y2Y6
    Secondary Accessions:
    • E1P631
    • Q9UFK2

    Protein attributes for TMEM98 Gene

    Size:
    226 amino acids
    Molecular mass:
    24611 Da
    Quaternary structure:
    • Interacts (via N-terminal region) with MYRF; the interaction inhibits MYRF self-cleavage.

neXtProt entry for TMEM98 Gene

Protein Expression for TMEM98 Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for TMEM98 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for TMEM98 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for TMEM98 Gene

Domains & Families for TMEM98 Gene

Gene Families for TMEM98 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted membrane proteins

Protein Domains for TMEM98 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for TMEM98 Gene

GenScript: Design optimal peptide antigens:
  • TMEM98 protein (A0AUK5_HUMAN)
  • Protein TADA1 (TMM98_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q9Y2Y6

UniProtKB/Swiss-Prot:

TMM98_HUMAN :
  • Belongs to the TMEM98 family.
Family:
  • Belongs to the TMEM98 family.
genes like me logo Genes that share domains with TMEM98: view

Function for TMEM98 Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for TMEM98 Gene

UniProtKB/Swiss-Prot Function:
Functions as a negative regulator of MYRF in oligodendrocyte differentiation and myelination. Interacts with the C-terminal of MYRF inhibiting MYRF self-cleavage and N-fragment nuclear translocation. The secreted form promotes differentiation of T helper 1 cells (Th1).

Phenotypes From GWAS Catalog for TMEM98 Gene

genes like me logo Genes that share phenotypes with TMEM98: view

Human Phenotype Ontology for TMEM98 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for TMEM98 Gene

MGI Knock Outs for TMEM98:
  • Tmem98 Tmem98<tm1a(EUCOMM)Wtsi>

Animal Model Products

  • Taconic Biosciences Mouse Models for TMEM98

CRISPR Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Transcription Factor Targets and HOMER Transcription for TMEM98 Gene

Localization for TMEM98 Gene

Subcellular locations from UniProtKB/Swiss-Prot for TMEM98 Gene

Cell membrane; Single-pass type II membrane protein. Secreted. Secreted, exosome. Endoplasmic reticulum membrane; Single-pass type II membrane protein. Note=Secreted by exosomes through a non-classical pathway. {ECO:0000269 PubMed:25946230}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TMEM98 gene
Compartment Confidence
plasma membrane 5
extracellular 5
endoplasmic reticulum 4
nucleus 3
cytosol 2

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nucleoplasm (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for TMEM98 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005615 extracellular space IDA,IEA 25946230
GO:0005783 endoplasmic reticulum IDA --
GO:0005789 endoplasmic reticulum membrane IEA --
GO:0005886 plasma membrane IEA,IDA 25946230
GO:0016020 membrane IEA --
genes like me logo Genes that share ontologies with TMEM98: view

Pathways & Interactions for TMEM98 Gene

PathCards logo

SuperPathways for TMEM98 Gene

No Data Available

Interacting Proteins for TMEM98 Gene

STRING Interaction Network Preview (showing top 2 STRING interactants - click image to see details)
STRING Interaction Network
Selected Interacting proteins: Q9Y2Y6-TMM98_HUMAN ENSP00000463245 for TMEM98 Gene via MINT STRING IID

GPS-Prot Interaction Network for TMEM98

Gene Ontology (GO) - Biological Process for TMEM98 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0010955 negative regulation of protein processing IEA --
GO:0031642 negative regulation of myelination IEA,ISS --
GO:0045063 T-helper 1 cell differentiation ISS,IEA --
GO:0048715 negative regulation of oligodendrocyte differentiation IEA,ISS --
GO:1900181 negative regulation of protein localization to nucleus IEA --
genes like me logo Genes that share ontologies with TMEM98: view

No data available for Pathways by source and SIGNOR curated interactions for TMEM98 Gene

Drugs & Compounds for TMEM98 Gene

Products:

  1. Drug
No Compound Related Data Available

Transcripts for TMEM98 Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for TMEM98 Gene

(3) REFSEQ mRNAs :
(8) Additional mRNA sequences :
(294) Selected AceView cDNA sequences:
(9) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for TMEM98 Gene

ExUns: 1a · 1b ^ 2 ^ 3a · 3b ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9a · 9b
SP1: - -
SP2: - -
SP3: - - -
SP4: -
SP5: - -
SP6:

Relevant External Links for TMEM98 Gene

GeneLoc Exon Structure for
TMEM98
ECgene alternative splicing isoforms for
TMEM98

Expression for TMEM98 Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TMEM98 Gene

mRNA expression in normal human tissues for TMEM98 Gene
mRNA expression by GTEx for TMEM98 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for TMEM98 Gene

This gene is overexpressed in Testis (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for TMEM98 Gene



Protein tissue co-expression partners for TMEM98 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of TMEM98 Gene:

TMEM98

SOURCE GeneReport for Unigene cluster for TMEM98 Gene:

Hs.3447

mRNA Expression by UniProt/SwissProt for TMEM98 Gene:

Q9Y2Y6-TMM98_HUMAN
Tissue specificity: Widely expressed with high expression in the ovary, pancreas and prostate (PubMed:25946230). Expressed in the eye, particularly in corneal endothelium, iris, ciliary body, sclera, optic nerve, optic nerve head, and retina (PubMed:24852644). Expressed by activated peripheral blood mononuclear cells (PubMed:25946230).

Evidence on tissue expression from TISSUES for TMEM98 Gene

  • Nervous system(4.7)
  • Muscle(4.2)
  • Eye(2.5)
  • Heart(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for TMEM98 Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • nervous
  • skeletal muscle
Regions:
Head and neck:
  • brain
  • cranial nerve
  • eye
  • head
General:
  • peripheral nervous system
genes like me logo Genes that share expression patterns with TMEM98: view

No data available for mRNA differential expression in normal tissues for TMEM98 Gene

Orthologs for TMEM98 Gene

This gene was present in the common ancestor of animals.

Orthologs for TMEM98 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia TMEM98 33 32
  • 99.85 (n)
 OneToOne
oppossum
(Monodelphis domestica)
 Mammalia TMEM98 33
  • 96 (a)
 OneToOne
platypus
(Ornithorhynchus anatinus)
 Mammalia TMEM98 33
  • 94 (a)
 OneToOne
dog
(Canis familiaris)
 Mammalia TMEM98 33 32
  • 90.56 (n)
 OneToOne
cow
(Bos Taurus)
 Mammalia TMEM98 33 32
  • 90.41 (n)
 OneToOne
rat
(Rattus norvegicus)
 Mammalia Tmem98 32
  • 89.23 (n)
mouse
(Mus musculus)
 Mammalia Tmem98 17 33 32
  • 88.5 (n)
lizard
(Anolis carolinensis)
 Reptilia TMEM98 33
  • 85 (a)
 OneToOne
tropical clawed frog
(Silurana tropicalis)
 Amphibia tmem98 32
  • 74.48 (n)
zebrafish
(Danio rerio)
 Actinopterygii tmem98 33 32
  • 74.5 (n)
 OneToOne
worm
(Caenorhabditis elegans)
 Secernentea K10C3.4 33
  • 15 (a)
 OneToOne
Species where no ortholog for TMEM98 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for TMEM98 Gene

ENSEMBL:
Gene Tree for TMEM98 (if available)
TreeFam:
Gene Tree for TMEM98 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for TMEM98: view image

Paralogs for TMEM98 Gene

Pseudogenes.org Pseudogenes for TMEM98 Gene

genes like me logo Genes that share paralogs with TMEM98: view

No data available for Paralogs for TMEM98 Gene

Variants for TMEM98 Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Sequence variations from dbSNP and Humsavar for TMEM98 Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs587777690 pathogenic, Nanophthalmos 4, Nanophthalmos 4 (NNO4) [MIM:615972] 32,940,889(+) G/C/T coding_sequence_variant, missense_variant
rs869312733 pathogenic, Nanophthalmos 4, Nanophthalmos 4 (NNO4) [MIM:615972] 32,940,899(+) A/C coding_sequence_variant, missense_variant
rs869312734 pathogenic, Nanophthalmos 4 32,933,276(+) GGAGAATGAAGACTGGATCGAAGATGCCTCGTAAGG/GG coding_sequence_variant, intron_variant, splice_donor_variant
rs1000161412 -- 32,930,578(+) C/A/T intron_variant
rs1000300782 -- 32,942,065(+) A/G 3_prime_UTR_variant, downstream_transcript_variant, genic_downstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for TMEM98 Gene

Variant ID Type Subtype PubMed ID
esv24161 CNV loss 19812545
esv2667652 CNV deletion 23128226
nsv510705 CNV deletion 20534489
nsv833417 CNV gain 17160897

Variation tolerance for TMEM98 Gene

Residual Variation Intolerance Score: 40.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.82; 34.17% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for TMEM98 Gene

Human Gene Mutation Database (HGMD)
TMEM98
SNPedia medical, phenotypic, and genealogical associations of SNPs for
TMEM98

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TMEM98 Gene

Disorders for TMEM98 Gene

MalaCards: The human disease database

(4) MalaCards diseases for TMEM98 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
nanophthalmos 4
  • nno4
microphthalmia
  • microphthalmos
farsightedness
  • far-sightedness
cervical adenosquamous carcinoma
  • adenosquamous carcinoma of cervix
- elite association - COSMIC cancer census association via MalaCards

UniProtKB/Swiss-Prot

TMM98_HUMAN
  • Nanophthalmos 4 (NNO4) [MIM:615972]: A rare disorder of eye development characterized by extreme hyperopia (farsightedness) and small functional eyes. The cornea and lens are normal in size and shape. Hyperopia occurs because insufficient growth along the visual axis places these lensing components too close to the retina. Nanophthalmic eyes show considerable thickening of both the choroidal vascular bed and scleral coat, which provide nutritive and structural support for the retina. {ECO:0000269 PubMed:24852644, ECO:0000269 PubMed:26392740}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for TMEM98

Genetic Association Database
(GAD)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with TMEM98: view

No data available for Genatlas for TMEM98 Gene

Publications for TMEM98 Gene

  1. Toward a catalog of human genes and proteins: sequencing and analysis of 500 novel complete protein coding human cDNAs. (PMID: 11230166) Wiemann S … Poustka A (Genome research 2001) 2 3 4 56
  2. The Secreted Form of Transmembrane Protein 98 Promotes the Differentiation of T Helper 1 Cells. (PMID: 25946230) Fu W … Han W (Journal of interferon & cytokine research : the official journal of the International Society for Interferon and Cytokine Research 2015) 3 4 56
  3. Novel TMEM98 mutations in pedigrees with autosomal dominant nanophthalmos. (PMID: 26392740) Khorram D … Fingert JH (Molecular vision 2015) 3 4 56
  4. Mutation in TMEM98 in a large white kindred with autosomal dominant nanophthalmos linked to 17p12-q12. (PMID: 24852644) Awadalla MS … Craig JE (JAMA ophthalmology 2014) 3 4 56
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 56

ExternalLinks

View latest publications for TMEM98 gene in Mastermind

Products for TMEM98 Gene

Sources for TMEM98 Gene