Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TMEM80 Gene

Aliases for TMEM80 Gene

  • Transmembrane Protein 80 2 3 4 5

External Ids for TMEM80 Gene

Previous GeneCards Identifiers for TMEM80 Gene

  • GC11P000512

Summaries for TMEM80 Gene

GeneCards Summary for TMEM80 Gene

TMEM80 (Transmembrane Protein 80) is a Protein Coding gene. Diseases associated with TMEM80 include Orofaciodigital Syndrome Vi and Meckel Syndrome, Type 1. An important paralog of this gene is TMEM216.

Additional gene information for TMEM80 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TMEM80 Gene

Genomics for TMEM80 Gene

GeneHancer (GH) Regulatory Elements for TMEM80 Gene

Promoters and enhancers for TMEM80 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH11J000690 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 644.8 -0.3 -343 8.7 HDGF CTCF ZFX ELF3 ZKSCAN8 MNT CBFA2T2 ZNF148 NKRF POLR2A TMEM80 EPS8L2 DEAF1 HRAS DRD4
GH11J000702 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 625.3 +11.7 11655 9.5 ELF3 MNT POLR2A CEBPG RERE AHR TFE3 ELF1 SP1 PPARG EPS8L2 TMEM80 DEAF1 PGGHG HRAS GC11P000712 ENSG00000269915
GH11J000803 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 52 +113.3 113298 10.7 HDGF ZFX ZNF652 SP1 CC2D1A ELF3 MNT SIX5 ZNF148 NKRF RPLP2 PIDD1 TMEM80 PHRF1 ENSG00000255108 SNORA52 ENSG00000255237 BET1L TSPAN4 PSMD13
GH11J000324 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 37.7 -367.5 -367532 7.8 SP1 ELF3 CC2D1A ZKSCAN8 CBFA2T2 ZNF148 NKRF MLLT1 GTF2F1 ZNF687 ENSG00000270030 ENSG00000255328 IFITM3 LOC105376504 TMEM80 TSPAN4 ENSG00000251661 RIC8A PHRF1 SNORA52
GH11J000839 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 34.8 +148.4 148353 7.6 HDGF MTA3 SP1 ELF3 ZFX MNT SIX5 ZNF148 NKRF POLR2A TSPAN4 POLR2L GC11M000841 CD151 TMEM80 PIDD1 SNORA52 RPLP2 ENSG00000255237 RIC8A
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around TMEM80 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the TMEM80 gene promoter:
  • AML1a
  • AP-4
  • c-Ets-1
  • CP2
  • GCNF
  • GCNF-1
  • GCNF-2
  • MyoD
  • NF-1
  • SRY

Genomic Locations for TMEM80 Gene

Genomic Locations for TMEM80 Gene
chr11:695,428-705,028
(GRCh38/hg38)
Size:
9,601 bases
Orientation:
Plus strand
chr11:695,428-705,028
(GRCh37/hg19)
Size:
9,601 bases
Orientation:
Plus strand

Genomic View for TMEM80 Gene

Genes around TMEM80 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TMEM80 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TMEM80 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TMEM80 Gene

Proteins for TMEM80 Gene

  • Protein details for TMEM80 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q96HE8-TMM80_HUMAN
    Recommended name:
    Transmembrane protein 80
    Protein Accession:
    Q96HE8
    Secondary Accessions:
    • A0A0A0MS80
    • A8MQ01
    • A8MXY8
    • B7WNU5

    Protein attributes for TMEM80 Gene

    Size:
    216 amino acids
    Molecular mass:
    23077 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=CB962031; Type=Miscellaneous discrepancy; Note=Sequence of unknown origin at the N-terminal part.; Evidence={ECO:0000305}; Sequence=EAX02373.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305};

    Alternative splice isoforms for TMEM80 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for TMEM80 Gene

Post-translational modifications for TMEM80 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for TMEM80 Gene

Domains & Families for TMEM80 Gene

Gene Families for TMEM80 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins
  • Predicted membrane proteins

Protein Domains for TMEM80 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for TMEM80 Gene

GenScript: Design optimal peptide antigens:
  • Transmembrane protein 80 (TMM80_HUMAN)

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with TMEM80: view

No data available for UniProtKB/Swiss-Prot for TMEM80 Gene

Function for TMEM80 Gene

Phenotypes From GWAS Catalog for TMEM80 Gene

genes like me logo Genes that share phenotypes with TMEM80: view

Animal Model Products

CRISPR Products

Clone Products

  • Applied Biological Materials (abm): Clones for TMEM80 - Now 50% OFF >
  • * TMEM80 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * TMEM80 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for TMEM80 Gene

Localization for TMEM80 Gene

Subcellular locations from UniProtKB/Swiss-Prot for TMEM80 Gene

Membrane; Multi-pass membrane protein. Cell projection, cilium. Note=Localizes at the transition zone, a region between the basal body and the ciliary axoneme. {ECO:0000250 UniProtKB:Q9D3H0}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TMEM80 gene
Compartment Confidence
plasma membrane 2
endoplasmic reticulum 0

Subcellular locations from the

Human Protein Atlas (HPA)
  • Golgi apparatus (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for TMEM80 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
GO:0035869 ciliary transition zone IBA 21873635
GO:0042995 cell projection IEA --
genes like me logo Genes that share ontologies with TMEM80: view

Pathways & Interactions for TMEM80 Gene

PathCards logo

SuperPathways for TMEM80 Gene

No Data Available

Interacting Proteins for TMEM80 Gene

Gene Ontology (GO) - Biological Process for TMEM80 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:1905515 non-motile cilium assembly IBA 21873635
genes like me logo Genes that share ontologies with TMEM80: view

No data available for Pathways by source and SIGNOR curated interactions for TMEM80 Gene

Drugs & Compounds for TMEM80 Gene

No Compound Related Data Available

Transcripts for TMEM80 Gene

Unigene Clusters for TMEM80 Gene

Transmembrane protein 80:
Representative Sequences:

CRISPR Products

Clone Products

  • Applied Biological Materials (abm): Clones for TMEM80 - Now 50% OFF >
  • * TMEM80 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * TMEM80 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

Alternative Splicing Database (ASD) splice patterns (SP) for TMEM80 Gene

No ASD Table

Relevant External Links for TMEM80 Gene

GeneLoc Exon Structure for
TMEM80
ECgene alternative splicing isoforms for
TMEM80

Expression for TMEM80 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TMEM80 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for TMEM80 Gene

This gene is overexpressed in Liver, secretome (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for TMEM80 Gene



Protein tissue co-expression partners for TMEM80 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of TMEM80 Gene:

TMEM80

SOURCE GeneReport for Unigene cluster for TMEM80 Gene:

Hs.448664

Evidence on tissue expression from TISSUES for TMEM80 Gene

  • Intestine(4.2)
genes like me logo Genes that share expression patterns with TMEM80: view

No data available for mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for TMEM80 Gene

Orthologs for TMEM80 Gene

This gene was present in the common ancestor of chordates.

Orthologs for TMEM80 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia TMEM80 35 34
  • 98.94 (n)
OneToOne
cow
(Bos Taurus)
Mammalia TMEM80 35 34
  • 83.22 (n)
OneToOne
dog
(Canis familiaris)
Mammalia TMEM80 35 34
  • 78.32 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Tmem80 17 35 34
  • 74.86 (n)
chicken
(Gallus gallus)
Aves TMEM80 35 34
  • 61.47 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia TMEM80 35
  • 61 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia tmem80 34
  • 60.95 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 37 (a)
OneToMany
Species where no ortholog for TMEM80 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for TMEM80 Gene

ENSEMBL:
Gene Tree for TMEM80 (if available)
TreeFam:
Gene Tree for TMEM80 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for TMEM80: view image

Paralogs for TMEM80 Gene

Paralogs for TMEM80 Gene

(1) SIMAP similar genes for TMEM80 Gene using alignment to 3 proteins:

  • TMM80_HUMAN
  • E9PQJ9_HUMAN
  • S4R441_HUMAN

Pseudogenes.org Pseudogenes for TMEM80 Gene

genes like me logo Genes that share paralogs with TMEM80: view

Variants for TMEM80 Gene

Sequence variations from dbSNP and Humsavar for TMEM80 Gene

SNP ID Clin Chr 11 pos Variation AA Info Type
rs1400909690 uncertain-significance, Inborn genetic diseases 694,968(+) G/A/T upstream_transcript_variant
rs868034883 uncertain-significance, Inborn genetic diseases 694,940(+) C/A upstream_transcript_variant
rs371538775 likely-benign, not specified 694,817(+) G/A upstream_transcript_variant
rs752994574 likely-benign, not specified 694,953(+) GCGGCCGCGGCCGCCGCCGCCACAGCGGCCGCGGCCGCC/GCGGCCGCGGCCGCC upstream_transcript_variant
rs758787132 likely-benign, not specified 694,829(+) G/T upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for TMEM80 Gene

Variant ID Type Subtype PubMed ID
dgv182e199 CNV deletion 23128226
esv1638671 CNV insertion 17803354
esv2759794 CNV loss 17122850
esv3625074 CNV loss 21293372
nsv1140464 CNV tandem duplication 24896259
nsv1159791 CNV deletion 26073780
nsv469923 CNV loss 18288195
nsv522733 CNV loss 19592680
nsv552869 CNV loss 21841781
nsv832043 CNV loss 17160897

Additional Variant Information for TMEM80 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
TMEM80

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for TMEM80 Gene

Disorders for TMEM80 Gene

MalaCards: The human disease database

(3) MalaCards diseases for TMEM80 Gene - From: DISEASES

Disorder Aliases PubMed IDs
orofaciodigital syndrome vi
  • ofd6
meckel syndrome, type 1
  • mks1
joubert syndrome 1
  • jbts1
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for TMEM80

genes like me logo Genes that share disorders with TMEM80: view

No data available for UniProtKB/Swiss-Prot and Genatlas for TMEM80 Gene

Publications for TMEM80 Gene

  1. MKS5 and CEP290 Dependent Assembly Pathway of the Ciliary Transition Zone. (PMID: 26982032) Li C … Leroux MR (PLoS biology 2016) 2 3 58
  2. Basal vertebrates clarify the evolutionary history of ciliopathy-associated genes Tmem138 and Tmem216. (PMID: 22936720) Venkatesh B … Brenner S (Molecular biology and evolution 2013) 2 3 58
  3. E3 ubiquitin ligase RNF123 targets lamin B1 and lamin-binding proteins. (PMID: 29676528) Khanna R … Parnaik VK (The FEBS journal 2018) 3 58
  4. Cell cycle-dependent phosphorylation regulates RECQL4 pathway choice and ubiquitination in DNA double-strand break repair. (PMID: 29229926) Lu H … Bohr VA (Nature communications 2017) 3 58
  5. Pooled-matrix protein interaction screens using Barcode Fusion Genetics. (PMID: 27107012) Yachie N … Roth FP (Molecular systems biology 2016) 3 58

Products for TMEM80 Gene

Sources for TMEM80 Gene

Content
Loading form....