Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TMEM256-PLSCR3 Gene

Subcategory (RNA class) for TMEM256-PLSCR3 Gene

ncRNA

Quality Score for this RNA gene is

3

Aliases for TMEM256-PLSCR3 Gene

  • TMEM256-PLSCR3 Readthrough (NMD Candidate) 2 3 5
  • C17orf61-PLSCR3 3

External Ids for TMEM256-PLSCR3 Gene

Previous GeneCards Identifiers for TMEM256-PLSCR3 Gene

  • GC17M007296

Summaries for TMEM256-PLSCR3 Gene

Entrez Gene Summary for TMEM256-PLSCR3 Gene

  • This locus represents naturally occurring read-through transcription between the neighboring chromosome 17 open reading frame 61 (C17orf61) and phospholipid scramblase 3 (PLSCR3) genes. The read-through transcript is a candidate for nonsense-mediated mRNA decay (NMD), and is unlikely to produce a protein product. [provided by RefSeq, Jan 2011]

GeneCards Summary for TMEM256-PLSCR3 Gene

TMEM256-PLSCR3 (TMEM256-PLSCR3 Readthrough (NMD Candidate)) is an RNA Gene, and is affiliated with the ncRNA class. Gene Ontology (GO) annotations related to this gene include calcium ion binding and calcium-dependent protein binding. An important paralog of this gene is TMEM256.

Additional gene information for TMEM256-PLSCR3 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TMEM256-PLSCR3 Gene

Genomics for TMEM256-PLSCR3 Gene

GeneHancer (GH) Regulatory Elements for TMEM256-PLSCR3 Gene

Promoters and enhancers for TMEM256-PLSCR3 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH17I007401 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 550.8 +0.0 5 4.8 HDGF PKNOX1 FOXA2 MLX ZFP64 ARID4B SIN3A ZNF2 ZBTB7B YY1 NLGN2 TMEM256 TMEM256-PLSCR3 ENSG00000262089 EIF4A1 SNORD10 SPEM2 CNTROB POLR2A CHRNB1
GH17I007393 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 550.4 +9.8 9750 2.2 HDGF ATF1 ARNT ZFP64 ARID4B SIN3A DMAP1 ZNF2 ZNF48 GLIS2 PLSCR3 TMEM256-PLSCR3 RPL26 TNK1
GH17I007399 Enhancer 0.4 ENCODE 0.8 +3.9 3948 0.8 ZNF384 ZBTB33 CHRNB1 SPEM2 SPEM1 ACAP1 ENSG00000224647 NEURL4 TMEM102 FGF11 TNFSF12-TNFSF13 TNFSF12
GH17I007400 Enhancer 0.2 ENCODE 0.8 +3.3 3254 0.1 SPEM2 CHRNB1 ACAP1 NEURL4 ENSG00000224647 TMEM102 FGF11 TNFSF12 TNFSF12-TNFSF13 TMEM256-PLSCR3
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around TMEM256-PLSCR3 on UCSC Golden Path with GeneCards custom track

Genomic Locations for TMEM256-PLSCR3 Gene

Genomic Locations for TMEM256-PLSCR3 Gene
chr17:7,389,727-7,404,131
(GRCh38/hg38)
Size:
14,405 bases
Orientation:
Minus strand
chr17:7,293,046-7,307,450
(GRCh37/hg19)

Genomic View for TMEM256-PLSCR3 Gene

Genes around TMEM256-PLSCR3 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TMEM256-PLSCR3 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TMEM256-PLSCR3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TMEM256-PLSCR3 Gene

Proteins for TMEM256-PLSCR3 Gene

  • Protein details for TMEM256-PLSCR3 Gene (UniProtKB/TrEMBL)

    Protein Symbol:
    K7ENI6
    Recommended name:
    TMEM256-PLSCR3 readthrough (NMD candidate)
    Protein Accession:
    K7ENI6

    Protein attributes for TMEM256-PLSCR3 Gene

    Size:
    41 amino acids
    Molecular mass:
    3969 Da
    Quaternary structure:
    No Data Available
  • Protein details for TMEM256-PLSCR3 Gene (UniProtKB/TrEMBL)

    Protein Symbol:
    K7ERE1
    Recommended name:
    TMEM256-PLSCR3 readthrough (NMD candidate)
    Protein Accession:
    K7ERE1

    Protein attributes for TMEM256-PLSCR3 Gene

    Size:
    68 amino acids
    Molecular mass:
    7130 Da
    Quaternary structure:
    No Data Available
  • Protein details for TMEM256-PLSCR3 Gene (UniProtKB/TrEMBL)

    Protein Symbol:
    K7ESI7
    Recommended name:
    TMEM256-PLSCR3 readthrough (NMD candidate)
    Protein Accession:
    K7ESI7

    Protein attributes for TMEM256-PLSCR3 Gene

    Size:
    28 amino acids
    Molecular mass:
    3208 Da
    Quaternary structure:
    No Data Available

neXtProt entry for TMEM256-PLSCR3 Gene

Protein Expression for TMEM256-PLSCR3 Gene

Post-translational modifications for TMEM256-PLSCR3 Gene

No Post-translational modifications

Other Protein References for TMEM256-PLSCR3 Gene

No data available for DME Specific Peptides for TMEM256-PLSCR3 Gene

Domains & Families for TMEM256-PLSCR3 Gene

Protein Domains for TMEM256-PLSCR3 Gene

InterPro:
ProtoNet:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with TMEM256-PLSCR3: view

No data available for Gene Families , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for TMEM256-PLSCR3 Gene

Function for TMEM256-PLSCR3 Gene

Phenotypes for TMEM256-PLSCR3 Gene

genes like me logo Genes that share phenotypes with TMEM256-PLSCR3: view

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for TMEM256-PLSCR3 Gene

Localization for TMEM256-PLSCR3 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for TMEM256-PLSCR3 Gene

Pathways & Interactions for TMEM256-PLSCR3 Gene

SuperPathways for TMEM256-PLSCR3 Gene

No Data Available

Interacting Proteins for TMEM256-PLSCR3 Gene

Gene Ontology (GO) - Biological Process for TMEM256-PLSCR3 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for TMEM256-PLSCR3 Gene

Drugs & Compounds for TMEM256-PLSCR3 Gene

No Compound Related Data Available

Transcripts for TMEM256-PLSCR3 Gene

mRNA/cDNA for TMEM256-PLSCR3 Gene

(4) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for TMEM256-PLSCR3 Gene

No ASD Table

Relevant External Links for TMEM256-PLSCR3 Gene

GeneLoc Exon Structure for
TMEM256-PLSCR3
ECgene alternative splicing isoforms for
TMEM256-PLSCR3

Expression for TMEM256-PLSCR3 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TMEM256-PLSCR3 Gene

Protein differential expression in normal tissues from HIPED for TMEM256-PLSCR3 Gene

This gene is overexpressed in Bone (13.8) and Peripheral blood mononuclear cells (11.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from MOPED for TMEM256-PLSCR3 Gene



Protein tissue co-expression partners for TMEM256-PLSCR3 Gene

genes like me logo Genes that share expression patterns with TMEM256-PLSCR3: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for TMEM256-PLSCR3 Gene

Orthologs for TMEM256-PLSCR3 Gene

This gene was present in the common ancestor of animals.

Orthologs for TMEM256-PLSCR3 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia -- 34
  • 58 (a)
OneToMany
cow
(Bos Taurus)
Mammalia TMEM256 34
  • 54 (a)
OneToMany
mouse
(Mus musculus)
Mammalia Tmem256 34
  • 54 (a)
OneToMany
dog
(Canis familiaris)
Mammalia -- 34
  • 53 (a)
OneToMany
zebrafish
(Danio rerio)
Actinopterygii tmem256 34
  • 48 (a)
OneToMany
fruit fly
(Drosophila melanogaster)
Insecta CG42395 34
  • 12 (a)
ManyToMany
CG4686 34
  • 12 (a)
ManyToMany
worm
(Caenorhabditis elegans)
Secernentea Y106G6H.8 34
  • 17 (a)
OneToMany
Species where no ortholog for TMEM256-PLSCR3 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for TMEM256-PLSCR3 Gene

ENSEMBL:
Gene Tree for TMEM256-PLSCR3 (if available)
TreeFam:
Gene Tree for TMEM256-PLSCR3 (if available)

Paralogs for TMEM256-PLSCR3 Gene

Paralogs for TMEM256-PLSCR3 Gene

(4) SIMAP similar genes for TMEM256-PLSCR3 Gene using alignment to 6 proteins:

genes like me logo Genes that share paralogs with TMEM256-PLSCR3: view

Variants for TMEM256-PLSCR3 Gene

Sequence variations from dbSNP and Humsavar for TMEM256-PLSCR3 Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs886039795 likely-pathogenic, Short-rib thoracic dysplasia 3 with or without polydactyly 7,403,143(-) CACTCAGAGCCTGGTAGTAAAA/ intron_variant
rs1000034077 -- 7,391,555(-) T/A intron_variant
rs1000734578 -- 7,399,868(-) T/C intron_variant
rs1000770481 -- 7,399,487(-) C/G/T intron_variant
rs1000826837 -- 7,405,982(-) G/A upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for TMEM256-PLSCR3 Gene

Variant ID Type Subtype PubMed ID
esv1007381 CNV deletion 20482838
esv2422288 CNV deletion 17116639
esv2662967 CNV deletion 23128226
nsv1116185 CNV deletion 24896259
nsv457659 CNV loss 19166990
nsv470575 CNV loss 18288195
nsv523672 CNV loss 19592680
nsv574322 CNV loss 21841781
nsv952118 CNV deletion 24416366

Variation tolerance for TMEM256-PLSCR3 Gene

Gene Damage Index Score: 0.66; 14.01% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for TMEM256-PLSCR3 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
TMEM256-PLSCR3

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TMEM256-PLSCR3 Gene

Disorders for TMEM256-PLSCR3 Gene

Additional Disease Information for TMEM256-PLSCR3

No disorders were found for TMEM256-PLSCR3 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for TMEM256-PLSCR3 Gene

Publications for TMEM256-PLSCR3 Gene

  1. Expression of conjoined genes: another mechanism for gene regulation in eukaryotes. (PMID: 20967262) Prakash T … Taylor TD (PloS one 2010) 3 58
  2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 58

Products for TMEM256-PLSCR3 Gene

Sources for TMEM256-PLSCR3 Gene

Content
Loading form....