Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TM2D2 Gene

Aliases for TM2D2 Gene

  • TM2 Domain Containing 2 2 3 5
  • Beta-Amyloid-Binding Protein-Like Protein 1 3 4
  • BBP-Like Protein 1 3 4
  • BLP1 3 4
  • TM2 Domain-Containing Protein 2 3

External Ids for TM2D2 Gene

Previous GeneCards Identifiers for TM2D2 Gene

  • GC08M038968
  • GC08M038846
  • GC08M037379

Summaries for TM2D2 Gene

Entrez Gene Summary for TM2D2 Gene

  • The protein encoded by this gene contains a structural module related to that of the seven transmembrane domain G protein-coupled receptor superfamily. This protein has sequence and structural similarities to the beta-amyloid binding protein (BBP), but, unlike BBP, it does not regulate a response to beta-amyloid peptide. This protein may have regulatory roles in cell death or proliferation signal cascades. This gene has multiple alternatively spliced transcript variants which encode two different isoforms. [provided by RefSeq, Jul 2008]

GeneCards Summary for TM2D2 Gene

TM2D2 (TM2 Domain Containing 2) is a Protein Coding gene.

Additional gene information for TM2D2 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TM2D2 Gene

Genomics for TM2D2 Gene

GeneHancer (GH) Regulatory Elements for TM2D2 Gene

Promoters and enhancers for TM2D2 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH08I038995 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 550.8 -4.0 -3972 10.8 HDGF PKNOX1 FOXA2 SMAD1 MLX ARID4B SIN3A FEZF1 DMAP1 ZNF2 TM2D2 ADAM32 ENSG00000253645 HTRA4 PLEKHA2 ENSG00000272128 ADAM9 SNORD38D GC08M039019 GC08M038869
GH08I038379 Promoter/Enhancer 2.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 18.5 +613.3 613292 8.1 DMAP1 YY1 SLC30A9 ZNF213 E2F8 ZNF143 ZNF548 ZNF263 SP3 NFYC NSD3 LETM2 ENSG00000272092 DDHD2 RPS20P22 ERLIN2 ASH2L TM2D2 ENSG00000255201 LOC102723716
GH08I038764 Enhancer 1.8 FANTOM5 Ensembl ENCODE dbSUPER 18.3 +228.4 228428 7.5 HDGF PKNOX1 FOXA2 SMAD1 ARID4B SIN3A YBX1 ZNF2 IRF4 YY1 DDHD2 NSD3 TACC1 ENSG00000255201 ADGRA2 FGFR1 TM2D2 LETM2 EIF4EBP1 RPS20P22
GH08I039035 Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 16.2 -40.9 -40917 5.3 ATF1 FOXA2 ARNT SIN3A YY1 ATF7 FOS DEK ZNF202 REST ADAM32 ADAM9 TM2D2 ENSG00000255201 ENSG00000272128 HTRA4 TACC1 PLEKHA2 SNORD38D GC08M039019
GH08I038898 Promoter/Enhancer 2.4 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 10.6 +94.6 94630 6.8 HDGF PKNOX1 FEZF1 GTF3C2 ZNF121 ZNF766 ZNF143 ATF7 FOS RUNX3 PLEKHA2 HTRA4 ENSG00000253645 ADAM9 TM2D2 TACC1 DDHD2 C8orf86 GC08M038869
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around TM2D2 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the TM2D2 gene promoter:

Genomic Locations for TM2D2 Gene

Genomic Locations for TM2D2 Gene
chr8:38,988,808-38,996,824
(GRCh38/hg38)
Size:
8,017 bases
Orientation:
Minus strand
chr8:38,846,327-38,854,343
(GRCh37/hg19)

Genomic View for TM2D2 Gene

Genes around TM2D2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TM2D2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TM2D2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TM2D2 Gene

Proteins for TM2D2 Gene

  • Protein details for TM2D2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9BX73-TM2D2_HUMAN
    Recommended name:
    TM2 domain-containing protein 2
    Protein Accession:
    Q9BX73
    Secondary Accessions:
    • B2RBK4
    • D3DSX8
    • Q8N0X9

    Protein attributes for TM2D2 Gene

    Size:
    214 amino acids
    Molecular mass:
    22871 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for TM2D2 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for TM2D2 Gene

Post-translational modifications for TM2D2 Gene

No data available for DME Specific Peptides for TM2D2 Gene

Domains & Families for TM2D2 Gene

Gene Families for TM2D2 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins
  • Predicted membrane proteins
  • Predicted secreted proteins

Protein Domains for TM2D2 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for TM2D2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q9BX73

UniProtKB/Swiss-Prot:

TM2D2_HUMAN :
  • Belongs to the TM2 family.
Family:
  • Belongs to the TM2 family.
genes like me logo Genes that share domains with TM2D2: view

Function for TM2D2 Gene

Phenotypes for TM2D2 Gene

genes like me logo Genes that share phenotypes with TM2D2: view

Animal Model Products

CRISPR Products

miRNA for TM2D2 Gene

Inhibitory RNA Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for TM2D2 Gene

Localization for TM2D2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for TM2D2 Gene

Membrane; Multi-pass membrane protein.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TM2D2 gene
Compartment Confidence
plasma membrane 4
nucleus 2
extracellular 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nucleoplasm (2)
  • Plasma membrane (2)
  • Vesicles (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for TM2D2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with TM2D2: view

Pathways & Interactions for TM2D2 Gene

SuperPathways for TM2D2 Gene

No Data Available

Interacting Proteins for TM2D2 Gene

STRING Interaction Network Preview (showing 1 interactants - click image to see details)
http://version10.5.string-db.org/api/image/networkList?limit=0&targetmode=proteins&caller_identity=gene_cards&network_flavor=evidence&identifiers=9606.ENSP00000416050%0d%0a9606.ENSP00000250416%0d%0a
Selected Interacting proteins: Q9BX73-TM2D2_HUMAN ENSP00000416050 for TM2D2 Gene via MINT STRING IID

Gene Ontology (GO) - Biological Process for TM2D2 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for TM2D2 Gene

Drugs & Compounds for TM2D2 Gene

No Compound Related Data Available

Transcripts for TM2D2 Gene

Unigene Clusters for TM2D2 Gene

TM2 domain containing 2:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for TM2D2 Gene

ExUns: 1a · 1b · 1c · 1d · 1e · 1f ^ 2a · 2b ^ 3a · 3b ^ 4a · 4b ^ 5a · 5b · 5c · 5d · 5e
SP1: - - - -
SP2: - -
SP3: - - - - -
SP4: - - - -
SP5: - - -
SP6: -
SP7: - -
SP8:

Relevant External Links for TM2D2 Gene

GeneLoc Exon Structure for
TM2D2
ECgene alternative splicing isoforms for
TM2D2

Expression for TM2D2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TM2D2 Gene

Protein differential expression in normal tissues from HIPED for TM2D2 Gene

This gene is overexpressed in Heart (43.7), Fetal testis (8.7), and Testis (7.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for TM2D2 Gene



Protein tissue co-expression partners for TM2D2 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of TM2D2 Gene:

TM2D2

SOURCE GeneReport for Unigene cluster for TM2D2 Gene:

Hs.7471

mRNA Expression by UniProt/SwissProt for TM2D2 Gene:

Q9BX73-TM2D2_HUMAN
Tissue specificity: Widely expressed.

Evidence on tissue expression from TISSUES for TM2D2 Gene

  • Pancreas(4.3)
  • Nervous system(4.2)
genes like me logo Genes that share expression patterns with TM2D2: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for TM2D2 Gene

Orthologs for TM2D2 Gene

This gene was present in the common ancestor of animals.

Orthologs for TM2D2 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia TM2D2 33 34
  • 100 (n)
dog
(Canis familiaris)
Mammalia TM2D2 33 34
  • 91.9 (n)
cow
(Bos Taurus)
Mammalia TM2D2 33 34
  • 89.56 (n)
rat
(Rattus norvegicus)
Mammalia Tm2d2 33
  • 83.88 (n)
mouse
(Mus musculus)
Mammalia Tm2d2 33 16 34
  • 83.72 (n)
oppossum
(Monodelphis domestica)
Mammalia TM2D2 34
  • 82 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia TM2D2 34
  • 75 (a)
OneToOne
chicken
(Gallus gallus)
Aves TM2D2 33 34
  • 70.35 (n)
lizard
(Anolis carolinensis)
Reptilia TM2D2 34
  • 76 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia tm2d2 33
  • 66.84 (n)
zebrafish
(Danio rerio)
Actinopterygii tm2d2 33 34
  • 65.85 (n)
Dr.16550 33
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP002821 33
  • 58.11 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG11103 33 34
  • 56.43 (n)
worm
(Caenorhabditis elegans)
Secernentea C02F5.13 33 34
  • 54.14 (n)
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.8437 33
Species where no ortholog for TM2D2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for TM2D2 Gene

ENSEMBL:
Gene Tree for TM2D2 (if available)
TreeFam:
Gene Tree for TM2D2 (if available)

Paralogs for TM2D2 Gene

No data available for Paralogs for TM2D2 Gene

Variants for TM2D2 Gene

Sequence variations from dbSNP and Humsavar for TM2D2 Gene

SNP ID Clin Chr 08 pos Variation AA Info Type
rs148707472 benign, likely-benign, not specified, Cone-Rod Dystrophy, Recessive 38,997,141(-) C/A upstream_transcript_variant
rs1000030858 -- 38,993,968(-) CTTTACTTATCTTTACTTAT/CTTTACTTAT intron_variant
rs1000331919 -- 38,996,639(-) C/T 5_prime_UTR_variant, genic_upstream_transcript_variant, upstream_transcript_variant
rs1000716955 -- 38,996,653(-) T/C 5_prime_UTR_variant, genic_upstream_transcript_variant, upstream_transcript_variant
rs1000754451 -- 38,992,500(-) T/ intron_variant

Structural Variations from Database of Genomic Variants (DGV) for TM2D2 Gene

Variant ID Type Subtype PubMed ID
nsv820251 CNV loss 19587683

Variation tolerance for TM2D2 Gene

Residual Variation Intolerance Score: 48.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.94; 19.40% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for TM2D2 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
TM2D2

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TM2D2 Gene

Disorders for TM2D2 Gene

Additional Disease Information for TM2D2

No disorders were found for TM2D2 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for TM2D2 Gene

Publications for TM2D2 Gene

  1. beta -Amyloid peptide-induced apoptosis regulated by a novel protein containing a g protein activation module. (PMID: 11278849) Kajkowski EM … Ozenberger BA (The Journal of biological chemistry 2001) 2 3 4 58
  2. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 58
  3. The full-ORF clone resource of the German cDNA Consortium. (PMID: 17974005) Bechtel S … Schupp I (BMC genomics 2007) 4 58
  4. Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. (PMID: 16303743) Otsuki T … Isogai T (DNA research : an international journal for rapid publication of reports on genes and genomes 2005) 3 58
  5. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 4 58

Products for TM2D2 Gene

Sources for TM2D2 Gene

Content
Loading form....