Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TENT5A Gene

Aliases for TENT5A Gene

  • Terminal Nucleotidyltransferase 5A 2 3
  • Family With Sequence Similarity 46 Member A 2 3 5
  • HBV X-Transactivated Gene 11 Protein 3 4
  • HBV XAg-Transactivated Protein 11 3 4
  • C6orf37 3 4
  • FAM46A 3 5
  • XTP11 3 4
  • Putative Nucleotidyltransferase FAM46A 3
  • Chromosome 6 Open Reading Frame 37 2
  • Retinal Expressed Gene C6orf37 3
  • Protein FAM46A 3
  • EC 2.7.7.- 4
  • OI18 3

External Ids for TENT5A Gene

Previous HGNC Symbols for TENT5A Gene

  • C6orf37
  • FAM46A

Summaries for TENT5A Gene

GeneCards Summary for TENT5A Gene

TENT5A (Terminal Nucleotidyltransferase 5A) is a Protein Coding gene. Diseases associated with TENT5A include Osteogenesis Imperfecta, Type Xviii and Posterior Cortical Atrophy. An important paralog of this gene is TENT5C.

UniProtKB/Swiss-Prot for TENT5A Gene

  • Probable nucleotidyltransferase that may act as a non-canonical poly(A) RNA polymerase.

Gene Wiki entry for TENT5A Gene

Additional gene information for TENT5A Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TENT5A Gene

Genomics for TENT5A Gene

GeneHancer (GH) Regulatory Elements for TENT5A Gene

Promoters and enhancers for TENT5A Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH06J081748 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 650.7 +0.8 755 6.1 HDGF PKNOX1 MLX ARID4B SIN3A FEZF1 ZNF2 YY1 ZNF213 ZNF143 TENT5A LOC105377872
GH06J081787 Enhancer 0.9 Ensembl ENCODE 11 -34.8 -34755 1.1 IRF2 FOXA2 RARA YY1 FOSL2 NR2F6 FOS CREM MIXL1 GATAD2A ENSG00000219702 ENSG00000206886 TENT5A LINC02542 LOC105377873 LINC01526
GH06J081893 Enhancer 0.9 Ensembl ENCODE 10.7 -142.6 -142552 2.8 SOX13 MXI1 SAP130 MAX RAD21 ZNF7 YY1 CTBP1 GATA3 FOS TENT5A ENSG00000260574 LINC01526 LINC02542
GH06J081812 Enhancer 0.7 FANTOM5 Ensembl 13.5 -60.1 -60127 1.4 POLR2A MAFK RARA LINC01526 TENT5A ENSG00000206886 ENSG00000219702 LINC02542 LOC105377873
GH06J081833 Enhancer 0.8 Ensembl ENCODE 11.7 -81.7 -81715 1.4 ZNF146 JUN CEBPB EP300 RAD21 RFX5 JUND NFYB ZNF580 RCOR1 TENT5A ENSG00000219702 ENSG00000206886 LINC02542 LINC01526 ENSG00000260574
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around TENT5A on UCSC Golden Path with GeneCards custom track

Genomic Locations for TENT5A Gene

Genomic Locations for TENT5A Gene
chr6:81,491,439-81,752,774
(GRCh38/hg38)
Size:
261,336 bases
Orientation:
Minus strand
chr6:82,201,156-82,462,491
(GRCh37/hg19)
Size:
261,336 bases
Orientation:
Minus strand

Genomic View for TENT5A Gene

Genes around TENT5A on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TENT5A Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TENT5A Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TENT5A Gene

Proteins for TENT5A Gene

  • Protein details for TENT5A Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q96IP4-FA46A_HUMAN
    Recommended name:
    Putative nucleotidyltransferase FAM46A
    Protein Accession:
    Q96IP4
    Secondary Accessions:
    • A8K7U4
    • Q5TF86
    • Q8NFZ9
    • Q9BW32
    • Q9NXV5

    Protein attributes for TENT5A Gene

    Size:
    442 amino acids
    Molecular mass:
    49666 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=AAH00683.1; Type=Erroneous initiation; Evidence={ECO:0000305};

    Alternative splice isoforms for TENT5A Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for TENT5A Gene

Post-translational modifications for TENT5A Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for TENT5A Gene

Antibody Products

  • Abcam antibodies for TENT5A
  • Boster Bio Antibodies for TENT5A

No data available for DME Specific Peptides for TENT5A Gene

Domains & Families for TENT5A Gene

Gene Families for TENT5A Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for TENT5A Gene

Blocks:
InterPro:
ProtoNet:

Graphical View of Domain Structure for InterPro Entry

Q96IP4

UniProtKB/Swiss-Prot:

FA46A_HUMAN :
  • Belongs to the FAM46 family.
Family:
  • Belongs to the FAM46 family.
genes like me logo Genes that share domains with TENT5A: view

Function for TENT5A Gene

Molecular function for TENT5A Gene

UniProtKB/Swiss-Prot Function:
Probable nucleotidyltransferase that may act as a non-canonical poly(A) RNA polymerase.

Enzyme Numbers (IUBMB) for TENT5A Gene

Phenotypes From GWAS Catalog for TENT5A Gene

Gene Ontology (GO) - Molecular Function for TENT5A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003723 RNA binding HDA 22658674
GO:0005515 protein binding IPI 25814554
GO:0016740 transferase activity IEA --
GO:0016779 nucleotidyltransferase activity IEA --
genes like me logo Genes that share ontologies with TENT5A: view
genes like me logo Genes that share phenotypes with TENT5A: view

Human Phenotype Ontology for TENT5A Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

Clone Products

No data available for Animal Models , Transcription Factor Targets and HOMER Transcription for TENT5A Gene

Localization for TENT5A Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TENT5A gene
Compartment Confidence
nucleus 3
cytosol 3
plasma membrane 1
extracellular 1
cytoskeleton 1
mitochondrion 1
peroxisome 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Nucleoplasm (2)
See all subcellular structures

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for TENT5A Gene

Pathways & Interactions for TENT5A Gene

SuperPathways for TENT5A Gene

No Data Available

Gene Ontology (GO) - Biological Process for TENT5A Gene

None

No data available for Pathways by source and SIGNOR curated interactions for TENT5A Gene

Drugs & Compounds for TENT5A Gene

No Compound Related Data Available

Transcripts for TENT5A Gene

mRNA/cDNA for TENT5A Gene

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for TENT5A Gene

No ASD Table

Relevant External Links for TENT5A Gene

GeneLoc Exon Structure for
TENT5A
ECgene alternative splicing isoforms for
TENT5A

Expression for TENT5A Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

NURSA nuclear receptor signaling pathways regulating expression of TENT5A Gene:

TENT5A

mRNA Expression by UniProt/SwissProt for TENT5A Gene:

Q96IP4-FA46A_HUMAN
Tissue specificity: Widely expressed, with preferential expression observed in the retina compared to other ocular tissues.

Evidence on tissue expression from TISSUES for TENT5A Gene

  • Skin(4.2)
  • Intestine(4.1)
  • Eye(4)
genes like me logo Genes that share expression patterns with TENT5A: view

No data available for mRNA expression in normal human tissues , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners and Phenotype-based relationships between genes and organs from Gene ORGANizer for TENT5A Gene

Orthologs for TENT5A Gene

This gene was present in the common ancestor of animals.

Orthologs for TENT5A Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia FAM46A 34 33
  • 99.55 (n)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia FAM46A 34
  • 96 (a)
OneToOne
dog
(Canis familiaris)
Mammalia FAM46A 34 33
  • 94.9 (n)
OneToOne
cow
(Bos Taurus)
Mammalia FAM46A 34 33
  • 94.24 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Fam46a 34 33
  • 91.36 (n)
OneToOne
Tent5a 16
rat
(Rattus norvegicus)
Mammalia Fam46a 33
  • 91.02 (n)
oppossum
(Monodelphis domestica)
Mammalia FAM46A 34
  • 89 (a)
OneToOne
chicken
(Gallus gallus)
Aves FAM46A 34 33
  • 85.54 (n)
OneToOne
lizard
(Anolis carolinensis)
Reptilia FAM46A 34
  • 82 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia fam46a 33
  • 83.38 (n)
Str.1648 33
African clawed frog
(Xenopus laevis)
Amphibia Xl.13086 33
zebrafish
(Danio rerio)
Actinopterygii fam46a 34
  • 83 (a)
OneToMany
FAM46A (1 of 2) 34
  • 83 (a)
OneToMany
LOC100330676 33
  • 76.71 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG30497 34
  • 26 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea pqn-44 34
  • 35 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 50 (a)
OneToMany
Species where no ortholog for TENT5A was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for TENT5A Gene

ENSEMBL:
Gene Tree for TENT5A (if available)
TreeFam:
Gene Tree for TENT5A (if available)
Aminode:
Evolutionary constrained regions (ECRs) for TENT5A: view image

Paralogs for TENT5A Gene

Paralogs for TENT5A Gene

genes like me logo Genes that share paralogs with TENT5A: view

Variants for TENT5A Gene

Sequence variations from dbSNP and Humsavar for TENT5A Gene

SNP ID Clin Chr 06 pos Variation AA Info Type
rs754008809 benign, not specified 81,752,011(-) CCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCC/CCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCC/CCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCC/CCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCC coding_sequence_variant, inframe_deletion, inframe_insertion
rs1000090701 -- 81,746,497(-) G/C 3_prime_UTR_variant
rs1001210075 -- 81,752,299(-) G/A intron_variant
rs1001353149 -- 81,745,701(-) A/G downstream_transcript_variant
rs1001769585 -- 81,753,797(-) G/A upstream_transcript_variant

Variation tolerance for TENT5A Gene

Residual Variation Intolerance Score: 37.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.14; 38.93% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for TENT5A Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
TENT5A

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for TENT5A Gene

Disorders for TENT5A Gene

MalaCards: The human disease database

(3) MalaCards diseases for TENT5A Gene - From: OMIM, ClinVar, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
osteogenesis imperfecta, type xviii
  • oi18
posterior cortical atrophy
  • pca
retinitis pigmentosa
  • retinitis pigmentosa 1
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for TENT5A

genes like me logo Genes that share disorders with TENT5A: view

No data available for UniProtKB/Swiss-Prot and Genatlas for TENT5A Gene

Publications for TENT5A Gene

  1. FAM46 proteins are novel eukaryotic non-canonical poly(A) polymerases. (PMID: 27060136) Kuchta K … Ginalski K (Nucleic acids research 2016) 2 3 4 58
  2. Identification and characterization of C6orf37, a novel candidate human retinal disease gene on chromosome 6q14. (PMID: 12054608) Lagali PS … Ayyagari R (Biochemical and biophysical research communications 2002) 2 3 4 58
  3. Genetic analysis of FAM46A in Spanish families with autosomal recessive retinitis pigmentosa: characterisation of novel VNTRs. (PMID: 17803723) Barragán I … Antiñolo G (Annals of human genetics 2008) 2 3 58
  4. Identification of a novel VNTR polymorphism in C6orf37 and its association with colorectal cancer risk in Chinese population. (PMID: 16545789) Cui J … Yao C (Clinica chimica acta; international journal of clinical chemistry 2006) 3 4 58
  5. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58

Products for TENT5A Gene

Sources for TENT5A Gene

Content
Loading form....