Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TBR1 Gene

Aliases for TBR1 Gene

  • T-Box, Brain 1 2 3 5
  • T-Brain-1 3 4
  • TES-56 3 4
  • TBR-1 3 4
  • T-Box Brain Protein 1 3
  • T-Box, Brain, 1 2

External Ids for TBR1 Gene

Previous GeneCards Identifiers for TBR1 Gene

  • GC02P160326
  • GC02P160800
  • GC02P162236
  • GC02P162475
  • GC02P162098
  • GC02P161980
  • GC02P162272
  • GC02P154157

Summaries for TBR1 Gene

Entrez Gene Summary for TBR1 Gene

  • This gene is a member of a conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of numerous developmental processes. In mouse, the ortholog of this gene is expressed in the cerebral cortex, hippocampus, amygdala and olfactory bulb and is thought to play an important role in neuronal migration and axonal projection. In mouse, the C-terminal region of this protein was found to be necessary and sufficient for association with the guanylate kinase domain of calcium/calmodulin-dependent serine protein kinase. [provided by RefSeq, Dec 2015]

GeneCards Summary for TBR1 Gene

TBR1 (T-Box, Brain 1) is a Protein Coding gene. Diseases associated with TBR1 include Chromosome 2Q24 Microdeletion Syndrome and Mental Retardation And Microcephaly With Pontine And Cerebellar Hypoplasia. Among its related pathways are Neuroscience. Gene Ontology (GO) annotations related to this gene include DNA binding transcription factor activity and RNA polymerase II core promoter sequence-specific DNA binding. An important paralog of this gene is EOMES.

UniProtKB/Swiss-Prot for TBR1 Gene

  • Probable transcriptional regulator involved in developmental processes. Required for normal brain development.

Gene Wiki entry for TBR1 Gene

Additional gene information for TBR1 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TBR1 Gene

Genomics for TBR1 Gene

GeneHancer (GH) Regulatory Elements for TBR1 Gene

Promoters and enhancers for TBR1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH02I161414 Enhancer 0.9 Ensembl 550.8 -1.5 -1489 1.2 RB1 ARID4B SIN3A ZBTB7B ZNF48 ZNF335 GLIS2 MXD4 KAT8 ZNF148 TBR1 LINC01806 RNA5SP108
GH02I161416 Promoter 0.8 EPDnew 550.8 +0.2 184 0.1 CBX8 RNF2 NFYC ZNF384 EZH2 TBR1 ENSG00000224076
GH02I161237 Enhancer 2.2 VISTA UCNEbase FANTOM5 Ensembl ENCODE 13.6 -177.6 -177554 2.7 RB1 ZSCAN4 SIN3A NFXL1 ZNF335 GLIS2 ZNF366 SCRT2 ZNF143 BCLAF1 GC02M161236 GC02M161238 TBR1 LINC01806 AHCTF1P1 SLC4A10 LOC101929512
GH02I161683 Enhancer 0.2 FANTOM5 2.3 +267.5 267507 0.1 TBR1 KRT18P46 LOC105373722 SLC4A10
GH02I161423 Enhancer 0.4 Ensembl 0.4 +7.8 7847 1.8 RING1 SUZ12 EZH2 ENSG00000251621 SLC4A10 ENSG00000224076 LINC01806 TBR1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around TBR1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the TBR1 gene promoter:

Genomic Locations for TBR1 Gene

Genomic Locations for TBR1 Gene
chr2:161,416,094-161,425,870
(GRCh38/hg38)
Size:
9,777 bases
Orientation:
Plus strand
chr2:162,272,605-162,282,381
(GRCh37/hg19)

Genomic View for TBR1 Gene

Genes around TBR1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TBR1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TBR1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TBR1 Gene

Proteins for TBR1 Gene

  • Protein details for TBR1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q16650-TBR1_HUMAN
    Recommended name:
    T-box brain protein 1
    Protein Accession:
    Q16650
    Secondary Accessions:
    • B0AZS4
    • B2R6G5
    • Q14DC5
    • Q53TH0
    • Q56A81

    Protein attributes for TBR1 Gene

    Size:
    682 amino acids
    Molecular mass:
    74053 Da
    Quaternary structure:
    • Part of a complex containing CASK, TBR1 and TSPYL2; may modulate gene expression in response to neuronal synaptic activity.

    Alternative splice isoforms for TBR1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for TBR1 Gene

Post-translational modifications for TBR1 Gene

No Post-translational modifications

Other Protein References for TBR1 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • Cell Signaling Technology (CST) Antibodies for TBR1 (TBR1)
  • Abcam antibodies for TBR1

No data available for DME Specific Peptides for TBR1 Gene

Domains & Families for TBR1 Gene

Gene Families for TBR1 Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted intracellular proteins
  • Transcription factors

Suggested Antigen Peptide Sequences for TBR1 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with TBR1: view

No data available for UniProtKB/Swiss-Prot for TBR1 Gene

Function for TBR1 Gene

Molecular function for TBR1 Gene

UniProtKB/Swiss-Prot Function:
Probable transcriptional regulator involved in developmental processes. Required for normal brain development.

Phenotypes From GWAS Catalog for TBR1 Gene

Gene Ontology (GO) - Molecular Function for TBR1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000978 RNA polymerase II proximal promoter sequence-specific DNA binding IEA --
GO:0003677 DNA binding IEA --
GO:0003700 DNA binding transcription factor activity IEA,TAS --
GO:0019901 protein kinase binding IEA --
genes like me logo Genes that share ontologies with TBR1: view
genes like me logo Genes that share phenotypes with TBR1: view

Human Phenotype Ontology for TBR1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for TBR1 Gene

MGI Knock Outs for TBR1:

Clone Products

  • Addgene plasmids for TBR1

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for TBR1 Gene

Localization for TBR1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for TBR1 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TBR1 gene
Compartment Confidence
nucleus 5
cytosol 2
cytoskeleton 1

Gene Ontology (GO) - Cellular Components for TBR1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA --
genes like me logo Genes that share ontologies with TBR1: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for TBR1 Gene

Pathways & Interactions for TBR1 Gene

SuperPathway Contained pathways
1 Neuroscience
genes like me logo Genes that share pathways with TBR1: view

Pathways by source for TBR1 Gene

1 Cell Signaling Technology pathway for TBR1 Gene

Gene Ontology (GO) - Biological Process for TBR1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001661 conditioned taste aversion IEA --
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0007420 brain development TAS 7619531
GO:0010092 specification of animal organ identity IEA --
genes like me logo Genes that share ontologies with TBR1: view

No data available for SIGNOR curated interactions for TBR1 Gene

Drugs & Compounds for TBR1 Gene

No Compound Related Data Available

Transcripts for TBR1 Gene

Unigene Clusters for TBR1 Gene

T-box, brain, 1:
Representative Sequences:

Clone Products

  • Addgene plasmids for TBR1

Alternative Splicing Database (ASD) splice patterns (SP) for TBR1 Gene

No ASD Table

Relevant External Links for TBR1 Gene

GeneLoc Exon Structure for
TBR1
ECgene alternative splicing isoforms for
TBR1

Expression for TBR1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TBR1 Gene

mRNA differential expression in normal tissues according to GTEx for TBR1 Gene

This gene is overexpressed in Brain - Frontal Cortex (BA9) (x17.7), Brain - Cortex (x13.1), Brain - Anterior cingulate cortex (BA24) (x11.3), and Brain - Amygdala (x4.6).

Protein differential expression in normal tissues from HIPED for TBR1 Gene

This gene is overexpressed in Pancreas (28.7), Breast (21.3), and Lung (10.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for TBR1 Gene



Protein tissue co-expression partners for TBR1 Gene

NURSA nuclear receptor signaling pathways regulating expression of TBR1 Gene:

TBR1

SOURCE GeneReport for Unigene cluster for TBR1 Gene:

Hs.210862

mRNA Expression by UniProt/SwissProt for TBR1 Gene:

Q16650-TBR1_HUMAN
Tissue specificity: Brain.

Evidence on tissue expression from TISSUES for TBR1 Gene

  • Nervous system(5)
genes like me logo Genes that share expression patterns with TBR1: view

No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for TBR1 Gene

Orthologs for TBR1 Gene

This gene was present in the common ancestor of animals.

Orthologs for TBR1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia TBR1 33 34
  • 99.8 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia TBR1 34
  • 99 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia TBR1 34
  • 97 (a)
OneToOne
cow
(Bos Taurus)
Mammalia TBR1 33 34
  • 96.68 (n)
dog
(Canis familiaris)
Mammalia TBR1 33 34
  • 96.43 (n)
mouse
(Mus musculus)
Mammalia Tbr1 33 16 34
  • 95.01 (n)
rat
(Rattus norvegicus)
Mammalia Tbr1 33
  • 94.57 (n)
chicken
(Gallus gallus)
Aves TBR1 33 34
  • 89.59 (n)
lizard
(Anolis carolinensis)
Reptilia TBR1 34
  • 81 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia tbr1 33
  • 80.38 (n)
zebrafish
(Danio rerio)
Actinopterygii tbr1b 33 34
  • 76.13 (n)
tbr1 33
worm
(Caenorhabditis elegans)
Secernentea tbx-9 35 34
  • 42 (a)
tbx-8 35 34
  • 38 (a)
tbx-43 34
  • 27 (a)
ManyToMany
tbx-37 34
  • 26 (a)
ManyToMany
tbx-38 34
  • 24 (a)
ManyToMany
tbx-11 34
  • 23 (a)
ManyToMany
tbx-34 34
  • 22 (a)
ManyToMany
tbx-35 34
  • 20 (a)
ManyToMany
tbx-30 34
  • 18 (a)
ManyToMany
tbx-42 34
  • 18 (a)
ManyToMany
tbx-40 34
  • 17 (a)
ManyToMany
tbx-39 34
  • 16 (a)
ManyToMany
sea squirt
(Ciona savignyi)
Ascidiacea CSA.7001 34
  • 15 (a)
OneToMany
Species where no ortholog for TBR1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for TBR1 Gene

ENSEMBL:
Gene Tree for TBR1 (if available)
TreeFam:
Gene Tree for TBR1 (if available)

Paralogs for TBR1 Gene

Paralogs for TBR1 Gene

(8) SIMAP similar genes for TBR1 Gene using alignment to 4 proteins:

genes like me logo Genes that share paralogs with TBR1: view

Variants for TBR1 Gene

Sequence variations from dbSNP and Humsavar for TBR1 Gene

SNP ID Clin Chr 02 pos Variation AA Info Type
rs869312704 likely-pathogenic, not provided, Neurodevelopmental disorder 161,423,753(+) GCTGCAGGCTGCAGGCTGCA/GCTGCAGGCTGCAGGCTGCAGGCTGCA coding_sequence_variant, frameshift
rs1000035819 -- 161,419,106(+) C/T intron_variant
rs1000405813 -- 161,423,797(+) C/G coding_sequence_variant, missense_variant
rs1000709178 -- 161,415,683(+) G/A upstream_transcript_variant
rs1000792087 -- 161,422,780(+) G/C intron_variant

Structural Variations from Database of Genomic Variants (DGV) for TBR1 Gene

Variant ID Type Subtype PubMed ID
nsv1003307 CNV loss 25217958
esv3593156 CNV gain 21293372
esv3593155 CNV loss 21293372

Variation tolerance for TBR1 Gene

Residual Variation Intolerance Score: 11.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.08; 38.00% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for TBR1 Gene

Human Gene Mutation Database (HGMD)
TBR1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
TBR1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TBR1 Gene

Disorders for TBR1 Gene

MalaCards: The human disease database

(3) MalaCards diseases for TBR1 Gene - From: HGMD, Orphanet, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search TBR1 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for TBR1

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with TBR1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for TBR1 Gene

Publications for TBR1 Gene

  1. T-brain-1: a homolog of Brachyury whose expression defines molecularly distinct domains within the cerebral cortex. (PMID: 7619531) Bulfone A … Rubenstein JL (Neuron 1995) 2 3 4 58
  2. Generation and annotation of the DNA sequences of human chromosomes 2 and 4. (PMID: 15815621) Hillier LW … Wilson RK (Nature 2005) 3 4 58
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
  4. TbetaR-I(6A) polymorphism is not a tumor susceptibility allele in Macedonian colorectal cancer patients. Correspondence re: B. Pasche et al. Type I TbetaR-I(6A) Is a Candidate Tumor Susceptibility Allele. Cancer Res., 58: 2727-2732, 1998. (PMID: 11719470) Stefanovska AM … Spiroski M (Cancer research 2001) 3 44 58
  5. An organelle-specific protein landscape identifies novel diseases and molecular mechanisms. (PMID: 27173435) Boldt K … UK10K Rare Diseases Group (Nature communications 2016) 3 58

Products for TBR1 Gene

  • Addgene plasmids for TBR1

Sources for TBR1 Gene

Content
Loading form....