Free for academic non-profit institutions. Other users need a Commercial license

TBP Gene(Protein Coding)

TATA-Box Binding Protein

GCID:
GC06P170554
GIFtS:
54
Genes Participants
UDN Logo

Aliases for TBP Gene

Aliases for TBP Gene

  • TATA-Box Binding Protein 2 3 5
  • Transcription Initiation Factor TFIID TBP Subunit 3 4
  • TATA Sequence-Binding Protein 3 4
  • TATA-Box Factor 3 4
  • GTF2D1 3 4
  • TFIID 3 4
  • TATA-Box Binding Protein N-Terminal Domain 3
  • TATA-Box-Binding Protein 3
  • TATA-Binding Factor 4
  • GTF2D 3
  • SCA17 3
  • HDL4 3
  • TF2D 4

External Ids for TBP Gene

Previous HGNC Symbols for TBP Gene

  • GTF2D1
  • SCA17

Previous GeneCards Identifiers for TBP Gene

  • GC06P170058
  • GC06P170479
  • GC06P170719
  • GC06P170781
  • GC06P170705
  • GC06P168368
  • GC06P170863

Summaries for TBP Gene

Entrez Gene Summary for TBP Gene

  • Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]

GeneCards Summary for TBP Gene

TBP (TATA-Box Binding Protein) is a Protein Coding gene. Diseases associated with TBP include Spinocerebellar Ataxia 17 and Parkinson Disease, Late-Onset. Among its related pathways are Gene Expression and RNA Polymerase II Transcription Initiation And Promoter Clearance. Gene Ontology (GO) annotations related to this gene include DNA binding transcription factor activity and transcription factor binding. An important paralog of this gene is TBPL2.

UniProtKB/Swiss-Prot for TBP Gene

  • General transcription factor that functions at the core of the DNA-binding multiprotein factor TFIID (PubMed:2374612, PubMed:2363050, PubMed:2194289, PubMed:9836642, PubMed:27193682). Binding of TFIID to the TATA box is the initial transcriptional step of the pre-initiation complex (PIC), playing a role in the activation of eukaryotic genes transcribed by RNA polymerase II (PubMed:2374612, PubMed:2363050, PubMed:2194289, PubMed:9836642, PubMed:27193682). Component of a BRF2-containing transcription factor complex that regulates transcription mediated by RNA polymerase III (PubMed:26638071). Component of the transcription factor SL1/TIF-IB complex, which is involved in the assembly of the PIC (pre-initiation complex) during RNA polymerase I-dependent transcription (PubMed:15970593). The rate of PIC formation probably is primarily dependent on the rate of association of SL1 with the rDNA promoter. SL1 is involved in stabilization of nucleolar transcription factor 1/UBTF on rDNA.

Gene Wiki entry for TBP Gene

Additional gene information for TBP Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TBP Gene

Genomics for TBP Gene

Products:

  1. Regulatory Element

GeneHancer (GH) Regulatory Elements for TBP Gene

Promoters and enhancers for TBP Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH06J170551 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 699.8 -0.7 -652 5 MLX DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ZNF143 SP3 NFYC TBP PSMB1 PIR48716 WDR27 ENSG00000266896 FAM120B PDCD2 ERMARD
GH06J169700 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 58.1 -851.9 -851949 4.6 HDGF PKNOX1 MLX ARID4B SIN3A DMAP1 ZNF2 YY1 POLR2B ZNF213 WDR27 C6orf120 TBP FAM120B ENSG00000266896 LINC02519 ERMARD TCTE3 PDCD2 PHF10
GH06J169721 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 44.8 -830.1 -830136 4.7 PKNOX1 CLOCK FOXA2 MLX ARNT ZFP64 ARID4B SIN3A FEZF1 DMAP1 ERMARD PHF10 ENSG00000227704 ENSG00000232640 WDR27 TBP FAM120B ENSG00000266896 TCTE3 C6orf120
GH06J169750 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 44.1 -802.5 -802468 3.3 HDGF PKNOX1 SMAD1 FOXA2 MLX ARNT ZFP64 ARID4B SIN3A DMAP1 ERMARD GC06M169749 TCTE3 WDR27 TBP ENSG00000266896 FAM120B PDCD2 PSMB1 ENSG00000236173
GH06J170400 Enhancer 0.9 ENCODE 62.4 -153.8 -153834 0.5 HDGF FOXA2 ARNT NEUROD1 YBX1 TCF12 ZNF207 ATF7 ZNF548 NCOA1 WDR27 TBP ENSG00000266896 FAM120B ERMARD PDCD2 TCTE3 ENSG00000272848 PHF10 ENSG00000232640
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around TBP on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the TBP gene promoter:

Genomic Locations for TBP Gene

Genomic Locations for TBP Gene
chr6:170,554,302-170,572,870
(GRCh38/hg38)
Size:
18,569 bases
Orientation:
Plus strand
chr6:170,863,390-170,881,958
(GRCh37/hg19)

Genomic View for TBP Gene

Genes around TBP on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TBP Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TBP Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for TBP Gene

Proteins for TBP Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for TBP Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P20226-TBP_HUMAN
    Recommended name:
    TATA-box-binding protein
    Protein Accession:
    P20226
    Secondary Accessions:
    • B4E3B3
    • F5H869
    • Q16845
    • Q6IBM6
    • Q9UC02

    Protein attributes for TBP Gene

    Size:
    339 amino acids
    Molecular mass:
    37698 Da
    Quaternary structure:
    • Binds DNA as monomer (PubMed:2374612, PubMed:2194289). Belongs to the TFIID complex together with the TBP-associated factors (TAFs) (PubMed:9836642, PubMed:27007846). Part of a TFIID-containing RNA polymerase II pre-initiation complex that is composed of TBP and at least GTF2A1, GTF2A2, GTF2E1, GTF2E2, GTF2F1, GTF2H2, GTF2H3, GTF2H4, GTF2H5, GTF2B, TCEA1, ERCC2, ERCC3, TAF1, TAF2, TAF3, TAF4, TAF5, TAF6, TAF7, TAF8, TAF9, TAF10, TAF11, TAF12 and TAF13 (PubMed:27007846). Component of the transcription factor SL1/TIF-IB complex, composed of TBP and at least TAF1A, TAF1B, TAF1C and TAF1D (PubMed:7801123). Association of TBP to form either TFIID or SL1/TIF-IB appears to be mutually exclusive (PubMed:7801123). Interacts with TAF1A, TAF1B and TAF1C (PubMed:7801123). Interacts with TFIIB, NCOA6, DRAP1, DR1 and ELF3 (PubMed:10567404, PubMed:10391676, PubMed:11461703). Interacts with SPIB, SNAPC1, SNAPC2 and SNAPC4 (PubMed:10196196, PubMed:12621023). Interacts with UTF1 (PubMed:9748258). Interacts with BRF2; this interaction promotes recruitment of BRF2 to TATA box-containing promoters (PubMed:11564744, PubMed:26638071). Interacts with UBTF (PubMed:7982918). Interacts with GPBP1 (By similarity). Interacts with CITED2 (By similarity). Interacts with ATF7IP (Probable). Interacts with HIV-1 Tat (PubMed:8121496, PubMed:7608968, PubMed:15719058). Interacts with herpes simplex virus 1 ICP4 (PubMed:8392607). Interacts with human adenovirus E1A protein; this interaction probably disrupts the TBP-TATA complex (PubMed:8146144). Interacts with LLPH (By similarity). Interacts with HSF1 (via transactivation domain) (PubMed:11005381).

    Three dimensional structures from OCA and Proteopedia for TBP Gene

    Alternative splice isoforms for TBP Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for TBP Gene

Protein Expression for TBP Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for TBP Gene

  • Ubiquitination at posLast=243243 and isoforms=2181
  • Modification sites at PhosphoSitePlus

Other Protein References for TBP Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for TBP Gene

Domains & Families for TBP Gene

Gene Families for TBP Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins
  • Transcription factors

Protein Domains for TBP Gene

InterPro:
Blocks:
ProtoNet:

Suggested Antigen Peptide Sequences for TBP Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

P20226

UniProtKB/Swiss-Prot:

TBP_HUMAN :
  • Belongs to the TBP family.
Family:
  • Belongs to the TBP family.
genes like me logo Genes that share domains with TBP: view

Function for TBP Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for TBP Gene

UniProtKB/Swiss-Prot Function:
General transcription factor that functions at the core of the DNA-binding multiprotein factor TFIID (PubMed:2374612, PubMed:2363050, PubMed:2194289, PubMed:9836642, PubMed:27193682). Binding of TFIID to the TATA box is the initial transcriptional step of the pre-initiation complex (PIC), playing a role in the activation of eukaryotic genes transcribed by RNA polymerase II (PubMed:2374612, PubMed:2363050, PubMed:2194289, PubMed:9836642, PubMed:27193682). Component of a BRF2-containing transcription factor complex that regulates transcription mediated by RNA polymerase III (PubMed:26638071). Component of the transcription factor SL1/TIF-IB complex, which is involved in the assembly of the PIC (pre-initiation complex) during RNA polymerase I-dependent transcription (PubMed:15970593). The rate of PIC formation probably is primarily dependent on the rate of association of SL1 with the rDNA promoter. SL1 is involved in stabilization of nucleolar transcription factor 1/UBTF on rDNA.
GENATLAS Biochemistry:
TATA-box binding protein.component of the multisubunit complex TFIID,with a stretch of polyglutamine,ubiquitously expressed. Interacting with MYC

Phenotypes From GWAS Catalog for TBP Gene

Gene Ontology (GO) - Molecular Function for TBP Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000978 RNA polymerase II proximal promoter sequence-specific DNA binding IEA --
GO:0000981 RNA polymerase II transcription factor activity, sequence-specific DNA binding ISA --
GO:0000987 proximal promoter sequence-specific DNA binding IDA 16263792
GO:0001034 RNA polymerase III transcription factor activity, sequence-specific DNA binding IMP 26638071
GO:0001047 core promoter binding IDA 9841876
genes like me logo Genes that share ontologies with TBP: view
genes like me logo Genes that share phenotypes with TBP: view

Human Phenotype Ontology for TBP Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for TBP Gene

MGI Knock Outs for TBP:
  • Tbp Tbp<tm1Xjl>
  • Tbp Tbp<tm1Idvd>

Animal Model Products

miRNA for TBP Gene

miRTarBase miRNAs that target TBP

Transcription Factor Targets for TBP Gene

Selected GeneGlobe predicted Target genes for TBP
Targeted motifs for TBP Gene
HOMER Transcription Factor Regulatory Elements motif TBP
  • Consensus sequence: CCTTTTATAGCC Submotif: canonical Cell Type: NA

Clone Products

  • Addgene plasmids for TBP

No data available for Enzyme Numbers (IUBMB) for TBP Gene

Localization for TBP Gene

Subcellular locations from UniProtKB/Swiss-Prot for TBP Gene

Nucleus.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TBP gene
Compartment Confidence
nucleus 5
cytosol 3
extracellular 1
cytoskeleton 1
mitochondrion 1
peroxisome 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nucleoplasm (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for TBP Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000790 nuclear chromatin IDA 24289924
GO:0001939 female pronucleus IEA --
GO:0001940 male pronucleus IEA --
GO:0005634 nucleus IDA,IEA 9841876
GO:0005654 nucleoplasm TAS --
genes like me logo Genes that share ontologies with TBP: view

Pathways & Interactions for TBP Gene

SuperPathways for TBP Gene

PathCards logo More details on SuperPathways for TBP
SuperPathway Contained pathways
1 RNA Polymerase II Transcription Initiation And Promoter Clearance
Assembly of RNA Polymerase-II Initiation Complex
.91
Transcription of mRNA
.91
HIV Transcription Initiation
.71
RNA Polymerase II HIV Promoter Escape
.71
RNA Polymerase II Promoter Escape
.71
RNA Polymerase II Transcription Initiation
.71
RNA Polymerase II Transcription Initiation And Promoter Clearance
.71
RNA Polymerase II Transcription Pre-Initiation And Promoter Opening
.71
Basal transcription factors
.59
Eukaryotic Transcription Initiation
.53
Protein Acetylation and Deacetylation
.51
Crosstalk Between CARM1 and ESRs
.39
Transcription Ligand-Dependent Transcription of Retinoid-Target genes
.32
2 Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3
B-WICH complex positively regulates rRNA expression
.86
Positive epigenetic regulation of rRNA expression
.86
NoRC negatively regulates rRNA expression
.84
RNA Polymerase I Chain Elongation
.84
SIRT1 negatively regulates rRNA Expression
.84
Negative epigenetic regulation of rRNA expression
.82
RNA Polymerase I Transcription
.81
RNA Polymerase I Promoter Clearance
.81
RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription
.75
Epigenetic regulation of gene expression
.73
3 RNA Polymerase III Transcription Initiation
RNA Polymerase III Abortive And Retractive Initiation
.88
RNA Polymerase III Transcription
.88
RNA Polymerase III Transcription Initiation
.88
RNA Polymerase III Transcription Initiation From Type 1 Promoter
.78
RNA Polymerase III Transcription Initiation From Type 3 Promoter
.78
RNA Polymerase III Transcription Initiation From Type 2 Promoter
.76
4 HIV Life Cycle
HIV Life Cycle
.91
Late Phase of HIV Life Cycle
.91
HIV Infection
.64
Infectious disease
.61
Disease
.45
5 Formation of HIV-1 elongation complex containing HIV-1 Tat
RNA Polymerase II Pre-transcription Events
.83
Transcription of the HIV genome
.83
RNA Polymerase II Transcription
.55
RNA polymerase II transcribes snRNA genes
.30
genes like me logo Genes that share pathways with TBP: view

Gene Ontology (GO) - Biological Process for TBP Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006351 transcription, DNA-templated IEA --
GO:0006352 DNA-templated transcription, initiation IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0006357 regulation of transcription by RNA polymerase II IEA --
GO:0006359 regulation of transcription by RNA polymerase III IEA --
genes like me logo Genes that share ontologies with TBP: view

No data available for SIGNOR curated interactions for TBP Gene

Drugs & Compounds for TBP Gene

Products:

  1. Drug

(28) Drugs for TBP Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(23) Additional Compounds for TBP Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with TBP: view

Transcripts for TBP Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for TBP Gene

(177) Selected AceView cDNA sequences:
(13) Additional mRNA sequences :
(2) REFSEQ mRNAs :
(8) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for TBP Gene

TATA box binding protein:
Representative Sequences:

Clone Products

  • Addgene plasmids for TBP

Alternative Splicing Database (ASD) splice patterns (SP) for TBP Gene

ExUns: 1a · 1b ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7 ^ 8a · 8b · 8c ^ 9 ^ 10
SP1: - - - -
SP2: -
SP3: -
SP4: -
SP5:

Relevant External Links for TBP Gene

GeneLoc Exon Structure for
TBP
ECgene alternative splicing isoforms for
TBP

Expression for TBP Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TBP Gene

mRNA expression in normal human tissues for TBP Gene
mRNA expression by BioGPS for TBP GenemRNA expression by GTEx for TBP Gene

Protein differential expression in normal tissues from HIPED for TBP Gene

This gene is overexpressed in Pancreas (20.8), Islet of Langerhans (14.8), Blymphocyte (13.4), Ovary (10.6), and Placenta (9.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for TBP Gene



Protein tissue co-expression partners for TBP Gene

NURSA nuclear receptor signaling pathways regulating expression of TBP Gene:

TBP

SOURCE GeneReport for Unigene cluster for TBP Gene:

Hs.590872

mRNA Expression by UniProt/SwissProt for TBP Gene:

P20226-TBP_HUMAN
Tissue specificity: Widely expressed, with levels highest in the testis and ovary.

Evidence on tissue expression from TISSUES for TBP Gene

  • Nervous system(3.4)
  • Liver(2.4)
  • Blood(2.1)
  • Kidney(2)
  • Muscle(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for TBP Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • digestive
  • nervous
  • skeletal muscle
  • skeleton
  • urinary
Regions:
Head and neck:
  • brain
  • cerebellum
  • cranial nerve
  • eye
  • head
  • mouth
  • pharynx
Thorax:
  • esophagus
Abdomen:
  • stomach
Pelvis:
  • prostate
  • urinary bladder
Limb:
  • lower limb
  • upper limb
General:
  • peripheral nerve
  • peripheral nervous system
  • spinal cord
genes like me logo Genes that share expression patterns with TBP: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for TBP Gene

Orthologs for TBP Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for TBP Gene

Organism Taxonomy Gene Similarity Type Details
oppossum
(Monodelphis domestica)
 Mammalia TBP 34
  • 96 (a)
 OneToOne
chimpanzee
(Pan troglodytes)
 Mammalia TBP 34 33
  • 95.14 (n)
 OneToOne
cow
(Bos Taurus)
 Mammalia TBP 34 33
  • 90.6 (n)
 OneToOne
dog
(Canis familiaris)
 Mammalia TBP 34 33
  • 88.68 (n)
 OneToOne
mouse
(Mus musculus)
 Mammalia Tbp 16 34 33
  • 86.5 (n)
rat
(Rattus norvegicus)
 Mammalia Tbp 33
  • 86.06 (n)
platypus
(Ornithorhynchus anatinus)
 Mammalia TBP 34
  • 86 (a)
 OneToOne
chicken
(Gallus gallus)
 Aves TBP 34 33
  • 83 (n)
 OneToOne
lizard
(Anolis carolinensis)
 Reptilia TBP 34
  • 95 (a)
 OneToOne
tropical clawed frog
(Silurana tropicalis)
 Amphibia tbp 33
  • 79.14 (n)
Str.6374 33
African clawed frog
(Xenopus laevis)
 Amphibia Xl.6667 33
zebrafish
(Danio rerio)
 Actinopterygii tbp 34 33
  • 79.74 (n)
 OneToOne
sizc101n13.2 33
fruit fly
(Drosophila melanogaster)
 Insecta Trf 35
  • 62 (a)
Tbp 34 35
  • 54 (a)
 OneToMany
worm
(Caenorhabditis elegans)
 Secernentea tbp-1 34 35
  • 52 (a)
 OneToMany
K. lactis yeast
(Kluyveromyces lactis)
 Saccharomycetes KLLA0E10099g 33
  • 68.28 (n)
baker's yeast
(Saccharomyces cerevisiae)
 Saccharomycetes SPT15 36 34 33
  • 67.9 (n)
A. gosspyii yeast
(Ashbya gossypii)
 Saccharomycetes AGOS_AGR134W 33
  • 66.11 (n)
Alicante grape
(Vitis vinifera)
 eudicotyledons Vvi.2191 33
soybean
(Glycine max)
 eudicotyledons Gma.4412 33
rice
(Oryza sativa)
 Liliopsida Os10g0432300 33
  • 66.84 (n)
Os.18508 33
corn
(Zea mays)
 Liliopsida Zm.93 33
barley
(Hordeum vulgare)
 Liliopsida Hv.10645 33
wheat
(Triticum aestivum)
 Liliopsida Ta.15 33
bread mold
(Neurospora crassa)
 Ascomycetes NCU04770 33
  • 64.1 (n)
fission yeast
(Schizosaccharomyces pombe)
 Schizosaccharomycetes tbp1 33
  • 60.45 (n)
sea squirt
(Ciona savignyi)
 Ascidiacea CSA.10479 34
  • 58 (a)
 OneToMany
Cin.14174 33
sea squirt
(Ciona intestinalis)
 Ascidiacea Cin.14174 33
Species where no ortholog for TBP was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)

Evolution for TBP Gene

ENSEMBL:
Gene Tree for TBP (if available)
TreeFam:
Gene Tree for TBP (if available)
Aminode:
Evolutionary constrained regions (ECRs) for TBP: view image

Paralogs for TBP Gene

Paralogs for TBP Gene

(2) SIMAP similar genes for TBP Gene using alignment to 8 proteins:

  • TBP_HUMAN
  • H0Y6D8_HUMAN
  • Q32MN6_HUMAN
  • Q32MN7_HUMAN
  • Q6QR78_HUMAN
  • Q6UKI1_HUMAN
  • Q7Z6S4_HUMAN
  • Q7Z6S5_HUMAN
genes like me logo Genes that share paralogs with TBP: view

Variants for TBP Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Polymorphic Variants from UniProtKB/Swiss-Prot for TBP Gene

TBP_HUMAN-P20226
The poly-Gln region of TBP is highly polymorphic (25 to 42 repeats) in normal individuals and is expanded to about 47-63 repeats in spinocerebellar ataxia 17 (SCA17) patients.

Sequence variations from dbSNP and Humsavar for TBP Gene

SNP ID Clin Chr 06 pos Variation AA Info Type
rs193922935 pathogenic, risk-factor, Spinocerebellar ataxia 17, Parkinson disease, late-onset 170,561,907(+) GCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA coding_sequence_variant, inframe_insertion
rs752404282 likely-benign, not provided 170,561,959(+) CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA coding_sequence_variant, inframe_deletion, inframe_insertion
rs1042327 likely-benign, not specified 170,569,705(+) T/C coding_sequence_variant, synonymous_variant
rs55736770 likely-benign, not specified 170,561,952(+) A/G/T coding_sequence_variant, missense_variant, synonymous_variant
rs112083427 uncertain-significance, not provided 170,561,964(+) G/A coding_sequence_variant, synonymous_variant

Structural Variations from Database of Genomic Variants (DGV) for TBP Gene

Variant ID Type Subtype PubMed ID
dgv6208n100 CNV gain 25217958
dgv6209n100 CNV gain 25217958
esv2759497 CNV gain+loss 17122850
esv3571551 CNV loss 25503493
esv3611742 CNV gain 21293372
nsv1015584 CNV gain 25217958
nsv1033491 CNV loss 25217958
nsv428158 CNV gain 18775914
nsv605580 CNV gain 21841781
nsv830874 CNV loss 17160897

Variation tolerance for TBP Gene

Residual Variation Intolerance Score: 33.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.24; 5.39% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for TBP Gene

Human Gene Mutation Database (HGMD)
TBP
SNPedia medical, phenotypic, and genealogical associations of SNPs for
TBP

SNP Genotyping and Copy Number Assay Products

Disorders for TBP Gene

MalaCards: The human disease database

(21) MalaCards diseases for TBP Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search TBP in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

TBP_HUMAN
  • Spinocerebellar ataxia 17 (SCA17) [MIM:607136]: Spinocerebellar ataxia is a clinically and genetically heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement of the brainstem and spinal cord. SCA17 is an autosomal dominant cerebellar ataxia (ADCA) characterized by widespread cerebral and cerebellar atrophy, dementia and extrapyramidal signs. The molecular defect in SCA17 is the expansion of a CAG repeat in the coding region of TBP. Longer expansions result in earlier onset and more severe clinical manifestations of the disease. {ECO:0000269 PubMed:11313753, ECO:0000269 PubMed:11448935, ECO:0000269 PubMed:11939898}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for TBP

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with TBP: view

No data available for Genatlas for TBP Gene

Publications for TBP Gene

  1. SCA17, a novel autosomal dominant cerebellar ataxia caused by an expanded polyglutamine in TATA-binding protein. (PMID: 11448935) Nakamura K … Kanazawa I (Human molecular genetics 2001) 2 3 4 22 58
  2. The small nuclear RNA-activating protein 190 Myb DNA binding domain stimulates TATA box-binding protein-TATA box recognition. (PMID: 12621023) Hinkley CS … Henry RW (The Journal of biological chemistry 2003) 3 4 22 58
  3. A neurological disease caused by an expanded CAG trinucleotide repeat in the TATA-binding protein gene: a new polyglutamine disease? (PMID: 10484774) Koide R … Tsuji S (Human molecular genetics 1999) 3 4 22 58
  4. A nuclear factor, ASC-2, as a cancer-amplified transcriptional coactivator essential for ligand-dependent transactivation by nuclear receptors in vivo. (PMID: 10567404) Lee SK … Lee JW (The Journal of biological chemistry 1999) 3 4 22 58
  5. Evidence for functional interaction between the HIV-1 Tat transactivator and the TATA box binding protein in vivo. (PMID: 7608968) Veschambre P … Jalinot P (Journal of molecular biology 1995) 3 4 22 58

Products for TBP Gene

  • Addgene plasmids for TBP

Sources for TBP Gene