Aliases for TBP Gene
Aliases for TBP Gene
External Ids for TBP Gene
- HGNC: 11588
- Entrez Gene: 6908
- Ensembl: ENSG00000112592
- OMIM: 600075
- UniProtKB: P20226
Previous HGNC Symbols for TBP Gene
- GTF2D1
- SCA17
Previous GeneCards Identifiers for TBP Gene
- GC06P170058
- GC06P170479
- GC06P170719
- GC06P170781
- GC06P170705
- GC06P168368
- GC06P170863
Summaries for TBP Gene
-
Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]
GeneCards Summary for TBP Gene
TBP (TATA-Box Binding Protein) is a Protein Coding gene. Diseases associated with TBP include Spinocerebellar Ataxia 17 and Parkinson Disease, Late-Onset. Among its related pathways are Apoptotic Pathways in Synovial Fibroblasts and PEDF Induced Signaling. Gene Ontology (GO) annotations related to this gene include DNA binding transcription factor activity and transcription factor binding. An important paralog of this gene is TBPL2.
UniProtKB/Swiss-Prot for TBP Gene
-
General transcription factor that functions at the core of the DNA-binding multiprotein factor TFIID (PubMed:2374612, PubMed:2363050, PubMed:2194289, PubMed:9836642, PubMed:27193682). Binding of TFIID to the TATA box is the initial transcriptional step of the pre-initiation complex (PIC), playing a role in the activation of eukaryotic genes transcribed by RNA polymerase II (PubMed:2374612, PubMed:2363050, PubMed:2194289, PubMed:9836642, PubMed:27193682). Component of a BRF2-containing transcription factor complex that regulates transcription mediated by RNA polymerase III (PubMed:26638071). Component of the transcription factor SL1/TIF-IB complex, which is involved in the assembly of the PIC (pre-initiation complex) during RNA polymerase I-dependent transcription (PubMed:15970593). The rate of PIC formation probably is primarily dependent on the rate of association of SL1 with the rDNA promoter. SL1 is involved in stabilization of nucleolar transcription factor 1/UBTF on rDNA.
Additional gene information for TBP Gene
- Monarch Initiative
- Search for TBP at DataMed
- Search for TBP at HumanCyc
No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TBP Gene
Genomics for TBP Gene
GeneHancer (GH) Regulatory Elements for TBP Gene
Promoters and enhancers for TBP Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data dump
GeneHancers around TBP on UCSC Golden Path with GeneCards custom track
Regulatory Element Products
Genomic Locations for TBP Gene
Genomic Locations for TBP Gene
- chr6:170,554,302-170,572,870
- (GRCh38/hg38)
- Size:
- 18,569 bases
- Orientation:
- Plus strand
- chr6:170,863,390-170,881,958
- (GRCh37/hg19)
Genomic View for TBP Gene
Genes around TBP on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 6q27 by Ensembl
- 6q27 by Entrez Gene
- 6q27 by HGNC
TBP Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for TBP Gene
Proteins for TBP Gene
-
Protein details for TBP Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- P20226-TBP_HUMAN
- Recommended name:
- TATA-box-binding protein
- Protein Accession:
- P20226
- B4E3B3
- F5H869
- Q16845
- Q6IBM6
- Q9UC02
Protein attributes for TBP Gene
- Size:
- 339 amino acids
- Molecular mass:
- 37698 Da
- Quaternary structure:
-
- Binds DNA as monomer (PubMed:2374612, PubMed:2194289). Belongs to the TFIID complex together with the TBP-associated factors (TAFs) (PubMed:9836642, PubMed:27007846). Part of a TFIID-containing RNA polymerase II pre-initiation complex that is composed of TBP and at least GTF2A1, GTF2A2, GTF2E1, GTF2E2, GTF2F1, GTF2H2, GTF2H3, GTF2H4, GTF2H5, GTF2B, TCEA1, ERCC2, ERCC3, TAF1, TAF2, TAF3, TAF4, TAF5, TAF6, TAF7, TAF8, TAF9, TAF10, TAF11, TAF12 and TAF13 (PubMed:27007846). Component of the transcription factor SL1/TIF-IB complex, composed of TBP and at least TAF1A, TAF1B, TAF1C and TAF1D (PubMed:7801123). Association of TBP to form either TFIID or SL1/TIF-IB appears to be mutually exclusive (PubMed:7801123). Interacts with TAF1A, TAF1B and TAF1C (PubMed:7801123). Interacts with TFIIB, NCOA6, DRAP1, DR1 and ELF3 (PubMed:10567404, PubMed:10391676, PubMed:11461703). Interacts with SPIB, SNAPC1, SNAPC2 and SNAPC4 (PubMed:10196196, PubMed:12621023). Interacts with UTF1 (PubMed:9748258). Interacts with BRF2; this interaction promotes recruitment of BRF2 to TATA box-containing promoters (PubMed:11564744, PubMed:26638071). Interacts with UBTF (PubMed:7982918). Interacts with GPBP1 (By similarity). Interacts with CITED2 (By similarity). Interacts with ATF7IP (Probable). Interacts with HIV-1 Tat (PubMed:8121496, PubMed:7608968, PubMed:15719058). Interacts with herpes simplex virus 1 ICP4 (PubMed:8392607). Interacts with human adenovirus E1A protein; this interaction probably disrupts the TBP-TATA complex (PubMed:8146144). Interacts with LLPH (By similarity). Interacts with HSF1 (via transactivation domain) (PubMed:11005381).
Three dimensional structures from OCA and Proteopedia for TBP Gene
Protein Expression for TBP Gene
Post-translational modifications for TBP Gene
Other Protein References for TBP Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
-
Custom Antibody ServicesOriGene Antibodies for TBP
- Novus Biologicals Antibodies for TBP
-
Abcam antibodies for TBP
- Invitrogen Antibodies for TBP
- GeneTex TBP antibody for TBP
-
Santa Cruz Biotechnology (SCBT) Antibodies for TBP
- Sino Biological Antibodies for TBP
Protein Products
-
OriGene Purified Proteins for TBP
- Search Origene for MassSpec and Protein Over-expression Lysates for TBP
- Origene Custom Protein Services for TBP
-
Cloud-Clone Corp. Proteins for TBP
- Search GeneTex for Proteins for TBP
-
Abcam proteins for TBP
Assay Products
No data available for DME Specific Peptides for TBP Gene
Domains & Families for TBP Gene
Gene Families for TBP Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Disease related genes
- Predicted intracellular proteins
- Transcription factors
Protein Domains for TBP Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for TBP Gene
Graphical View of Domain Structure for InterPro Entry
P20226- Family:
-
- Belongs to the TBP family.
Function for TBP Gene
Molecular function for TBP Gene
- GENATLAS Biochemistry:
- TATA-box binding protein.component of the multisubunit complex TFIID,with a stretch of polyglutamine,ubiquitously expressed. Interacting with MYC
- UniProtKB/Swiss-Prot Function:
- General transcription factor that functions at the core of the DNA-binding multiprotein factor TFIID (PubMed:2374612, PubMed:2363050, PubMed:2194289, PubMed:9836642, PubMed:27193682). Binding of TFIID to the TATA box is the initial transcriptional step of the pre-initiation complex (PIC), playing a role in the activation of eukaryotic genes transcribed by RNA polymerase II (PubMed:2374612, PubMed:2363050, PubMed:2194289, PubMed:9836642, PubMed:27193682). Component of a BRF2-containing transcription factor complex that regulates transcription mediated by RNA polymerase III (PubMed:26638071). Component of the transcription factor SL1/TIF-IB complex, which is involved in the assembly of the PIC (pre-initiation complex) during RNA polymerase I-dependent transcription (PubMed:15970593). The rate of PIC formation probably is primarily dependent on the rate of association of SL1 with the rDNA promoter. SL1 is involved in stabilization of nucleolar transcription factor 1/UBTF on rDNA.
Phenotypes From GWAS Catalog for TBP Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000978 | RNA polymerase II proximal promoter sequence-specific DNA binding | IEA | -- |
| GO:0000979 | RNA polymerase II core promoter sequence-specific DNA binding | IEA | -- |
| GO:0000987 | proximal promoter sequence-specific DNA binding | IDA | 16263792 |
| GO:0001034 | RNA polymerase III transcription factor activity, sequence-specific DNA binding | IMP | 26638071 |
| GO:0001047 | core promoter binding | IDA | 9841876 |
Phenotypes for TBP Gene
- MGI mutant phenotypes for TBP:
- inferred from 6 alleles
- GenomeRNAi human phenotypes for TBP:
-
- Increased viability
- Increased vaccinia virus (VACV) infection
- Increased shRNA abundance (Z-score > 2)
- Decreased viability ratio
- Resistant to vaccinia virus (VACV-A4L) infection
- Decreased shRNA abundance (Z-score < -2)
- Increased HPV18 LCR reporter activity
- Decreased viability of wild-type and TP53 knockout cells
- Decreased DCP1a protein expression and assembly in processing bodies after arsenite stimulation
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for TBP
-
-
ViGene Biosciences lentiviral particle packaged cDNA for TBP gene
-
ViGene Biosciences ready-to-package AAV shRNAs for TBP gene
- Search ViGene Biosciences for TBP
CRISPR Products
-
OriGene CRISPR knockouts for TBP
- genomics-online: gRNA clones - Search results for 115 available TBP gene related products
- Overview of 115 available TBP gene related products
- Applied Biological Materials CRISPR for TBP
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for TBP
- GenScript: Design CRISPR guide RNA sequences for TBP
miRNA for TBP Gene
- miRTarBase miRNAs that target TBP
Transcription Factor Targets for TBP Gene
Targeted motifs for TBP Gene
HOMER Transcription Factor Regulatory Elements motif TBP
- Consensus sequence: CCTTTTATAGCC Submotif: canonical Cell Type: NA
miRNA Products
- Search ViGene Biosciences for TBP
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for TBP
- Browse OriGene Inhibitory RNA Products For TBP
- genomics-online: shRNA clones - Search results for 115 available TBP gene related products
- Overview of 115 available TBP gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for TBP gene
Clone Products
- VectorBuilder custom plasmid, inducible vectors for TBP
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for TBP
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for TBP
- Applied Biological Materials Clones for TBP
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for TBP
-
ViGene Biosciences adenoviral particle packaged cDNA for TBP gene
-
ViGene Biosciences lentiviral particle packaged cDNA for TBP gene
-
ViGene Biosciences ready-to-package AAV shRNAs for TBP gene
No data available for Enzyme Numbers (IUBMB) for TBP Gene
Localization for TBP Gene
Subcellular locations from UniProtKB/Swiss-Prot for TBP Gene
- Nucleus.
| Compartment | Confidence |
|---|---|
| nucleus | 5 |
| cytosol | 3 |
| extracellular | 1 |
| cytoskeleton | 1 |
| mitochondrion | 1 |
| peroxisome | 1 |
- Nucleoplasm (3)
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000790 | nuclear chromatin | IDA | 24289924 |
| GO:0001939 | female pronucleus | IEA | -- |
| GO:0001940 | male pronucleus | IEA | -- |
| GO:0005634 | nucleus | IDA,IEA | 9841876 |
| GO:0005654 | nucleoplasm | TAS | -- |
Pathways & Interactions for TBP Gene
Pathways by source for TBP Gene
5 BioSystems pathways for TBP Gene
39 Reactome pathways for TBP Gene
1 PharmGKB pathway for TBP Gene
7 KEGG pathways for TBP Gene
1 GeneGo (Thomson Reuters) pathway for TBP Gene
17 Qiagen pathways for TBP Gene
1 Cell Signaling Technology pathway for TBP Gene
Interacting Proteins for TBP Gene
Selected Interacting proteins:
ENSP00000230354
P20226-TBP_HUMAN
for TBP Gene via
STRING
MINT
IID
UniProtKB
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0006351 | transcription, DNA-templated | IEA | -- |
| GO:0006352 | DNA-templated transcription, initiation | IEA | -- |
| GO:0006355 | regulation of transcription, DNA-templated | IEA | -- |
| GO:0006359 | regulation of transcription by RNA polymerase III | IEA | -- |
| GO:0006361 | transcription initiation from RNA polymerase I promoter | TAS | -- |
No data available for SIGNOR curated interactions for TBP Gene
Transcripts for TBP Gene
mRNA/cDNA for TBP Gene
- (2) REFSEQ mRNAs :
- (13) Additional mRNA sequences :
- (177) Selected AceView cDNA sequences:
- (8) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for TBP Gene
CRISPR Products
-
OriGene CRISPR knockouts for TBP
- genomics-online: gRNA clones - Search results for 115 available TBP gene related products
- Overview of 115 available TBP gene related products
- Applied Biological Materials CRISPR for TBP
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for TBP
- GenScript: Design CRISPR guide RNA sequences for TBP
miRNA Products
- Search ViGene Biosciences for TBP
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for TBP
- Browse OriGene Inhibitory RNA Products For TBP
- genomics-online: shRNA clones - Search results for 115 available TBP gene related products
- Overview of 115 available TBP gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for TBP gene
Clone Products
- VectorBuilder custom plasmid, inducible vectors for TBP
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for TBP
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for TBP
- Applied Biological Materials Clones for TBP
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
| ExUns: | 1a | · | 1b | ^ | 2 | ^ | 3 | ^ | 4 | ^ | 5a | · | 5b | ^ | 6 | ^ | 7 | ^ | 8a | · | 8b | · | 8c | ^ | 9 | ^ | 10 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | - | - | - | - | |||||||||||||||||||||||
| SP2: | - | ||||||||||||||||||||||||||
| SP3: | - | ||||||||||||||||||||||||||
| SP4: | - | ||||||||||||||||||||||||||
| SP5: |
Expression for TBP Gene
This gene is overexpressed in Pancreas (20.8), Islet of Langerhans (14.8), Blymphocyte (13.4), Ovary (10.6), and Placenta (9.5).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for TBP Gene
NURSA nuclear receptor signaling pathways regulating expression of TBP Gene:
TBPSOURCE GeneReport for Unigene cluster for TBP Gene:
Hs.590872mRNA Expression by UniProt/SwissProt for TBP Gene:
P20226-TBP_HUMAN
Tissue specificity:
Widely expressed, with levels highest in the testis and ovary.
Evidence on tissue expression from TISSUES for TBP Gene
- Nervous system(3.4)
- Liver(2.4)
- Blood(2.1)
- Muscle(2)
Phenotype-based relationships between genes and organs from Gene ORGANizer for TBP Gene
Germ Layers:
- ectoderm
- endoderm
- mesoderm
Systems:
- digestive
- nervous
- skeletal muscle
- skeleton
- urinary
Regions:
Head and neck:
- brain
- cerebellum
- cranial nerve
- eye
- head
- mouth
- pharynx
Thorax:
- esophagus
Abdomen:
- stomach
Pelvis:
- prostate
- urinary bladder
Limb:
- lower limb
- upper limb
General:
- peripheral nerve
- peripheral nervous system
- spinal cord
Primer Products
-
OriGene qPCR primer pairs and template standards for TBP
-
OriGene qPCR primer pairs for TBP
Gene Expression Assay Products
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for TBP Gene
Orthologs for TBP Gene
This gene was present in the common ancestor of eukaryotes.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| oppossum (Monodelphis domestica) |
Mammalia | TBP 34 |
|
OneToOne | |
| chimpanzee (Pan troglodytes) |
Mammalia | TBP 33 34 |
|
||
| cow (Bos Taurus) |
Mammalia | TBP 33 34 |
|
||
| dog (Canis familiaris) |
Mammalia | TBP 33 34 |
|
||
| mouse (Mus musculus) |
Mammalia | Tbp 33 16 34 |
|
||
| rat (Rattus norvegicus) |
Mammalia | Tbp 33 |
|
||
| platypus (Ornithorhynchus anatinus) |
Mammalia | TBP 34 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | TBP 33 34 |
|
||
| lizard (Anolis carolinensis) |
Reptilia | TBP 34 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | tbp 33 |
|
||
| Str.6374 33 |
|
||||
| African clawed frog (Xenopus laevis) |
Amphibia | Xl.6667 33 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | tbp 33 34 |
|
||
| sizc101n13.2 33 |
|
||||
| fruit fly (Drosophila melanogaster) |
Insecta | Tbp 35 34 |
|
||
| Trf 35 |
|
|
|||
| worm (Caenorhabditis elegans) |
Secernentea | tbp-1 35 34 |
|
||
| K. lactis yeast (Kluyveromyces lactis) |
Saccharomycetes | KLLA0E10099g 33 |
|
||
| baker's yeast (Saccharomyces cerevisiae) |
Saccharomycetes | SPT15 33 34 36 |
|
||
| A. gosspyii yeast (Ashbya gossypii) |
Saccharomycetes | AGOS_AGR134W 33 |
|
||
| soybean (Glycine max) |
eudicotyledons | Gma.4412 33 |
|
||
| Alicante grape (Vitis vinifera) |
eudicotyledons | Vvi.2191 33 |
|
||
| rice (Oryza sativa) |
Liliopsida | Os10g0432300 33 |
|
||
| Os.18508 33 |
|
||||
| barley (Hordeum vulgare) |
Liliopsida | Hv.10645 33 |
|
||
| wheat (Triticum aestivum) |
Liliopsida | Ta.15 33 |
|
||
| corn (Zea mays) |
Liliopsida | Zm.93 33 |
|
||
| bread mold (Neurospora crassa) |
Ascomycetes | NCU04770 33 |
|
||
| fission yeast (Schizosaccharomyces pombe) |
Schizosaccharomycetes | tbp1 33 |
|
||
| sea squirt (Ciona savignyi) |
Ascidiacea | CSA.10479 34 |
|
OneToMany | |
| sea squirt (Ciona intestinalis) |
Ascidiacea | Cin.14174 33 |
|
- Species where no ortholog for TBP was found in the sources mined by GeneCards:
-
- Actinobacteria (Mycobacterium tuberculosis)
- African malaria mosquito (Anopheles gambiae)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- beta proteobacteria (Neisseria meningitidis)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
Paralogs for TBP Gene
(2) SIMAP similar genes for TBP Gene using alignment to 8 proteins:
Variants for TBP Gene
Polymorphic Variants from UniProtKB/Swiss-Prot for TBP Gene
- TBP_HUMAN-P20226
- The poly-Gln region of TBP is highly polymorphic (25 to 42 repeats) in normal individuals and is expanded to about 47-63 repeats in spinocerebellar ataxia 17 (SCA17) patients.
| SNP ID | Clin | Chr 06 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs193922935 | pathogenic, risk-factor, Spinocerebellar ataxia 17, Parkinson disease, late-onset | 170,561,907(+) | GCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | coding_sequence_variant, inframe_insertion | |
| rs752404282 | likely-benign, not provided | 170,561,959(+) | CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | coding_sequence_variant, inframe_deletion, inframe_insertion | |
| rs1042327 | likely-benign, not specified | 170,569,705(+) | T/C | coding_sequence_variant, synonymous_variant | |
| rs55736770 | likely-benign, not specified | 170,561,952(+) | A/G/T | coding_sequence_variant, missense_variant, synonymous_variant | |
| rs112083427 | uncertain-significance, not provided | 170,561,964(+) | G/A | coding_sequence_variant, synonymous_variant |
| Variant ID | Type | Subtype | PubMed ID |
|---|---|---|---|
| dgv6208n100 | CNV | gain | 25217958 |
| dgv6209n100 | CNV | gain | 25217958 |
| esv2759497 | CNV | gain+loss | 17122850 |
| esv3571551 | CNV | loss | 25503493 |
| esv3611742 | CNV | gain | 21293372 |
| nsv1015584 | CNV | gain | 25217958 |
| nsv1033491 | CNV | loss | 25217958 |
| nsv428158 | CNV | gain | 18775914 |
| nsv605580 | CNV | gain | 21841781 |
| nsv830874 | CNV | loss | 17160897 |
Residual Variation Intolerance Score:
33.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
0.24;
5.39% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for TBP Gene
SNP Genotyping and Copy Number Assay Products
Disorders for TBP Gene
(22) MalaCards diseases for TBP Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| spinocerebellar ataxia 17 |
|
|
| parkinson disease, late-onset |
|
|
| gastrointestinal tuberculosis |
|
|
| autosomal dominant cerebellar ataxia |
|
|
| tuberculous peritonitis |
|
|
Search TBP in MalaCards
View complete list of genes associated with diseases
UniProtKB/Swiss-Prot
TBP_HUMAN- Spinocerebellar ataxia 17 (SCA17) [MIM:607136]: Spinocerebellar ataxia is a clinically and genetically heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement of the brainstem and spinal cord. SCA17 is an autosomal dominant cerebellar ataxia (ADCA) characterized by widespread cerebral and cerebellar atrophy, dementia and extrapyramidal signs. The molecular defect in SCA17 is the expansion of a CAG repeat in the coding region of TBP. Longer expansions result in earlier onset and more severe clinical manifestations of the disease. {ECO:0000269 PubMed:11313753, ECO:0000269 PubMed:11448935, ECO:0000269 PubMed:11939898}. Note=The disease is caused by mutations affecting the gene represented in this entry.
Additional Disease Information for TBP
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for Genatlas for TBP Gene
Publications for TBP Gene
- SCA17, a novel autosomal dominant cerebellar ataxia caused by an expanded polyglutamine in TATA-binding protein. (PMID: 11448935) Nakamura K … Kanazawa I (Human molecular genetics 2001) 2 3 4 22 58
- The small nuclear RNA-activating protein 190 Myb DNA binding domain stimulates TATA box-binding protein-TATA box recognition. (PMID: 12621023) Hinkley CS … Henry RW (The Journal of biological chemistry 2003) 3 4 22 58
- A neurological disease caused by an expanded CAG trinucleotide repeat in the TATA-binding protein gene: a new polyglutamine disease? (PMID: 10484774) Koide R … Tsuji S (Human molecular genetics 1999) 3 4 22 58
- A nuclear factor, ASC-2, as a cancer-amplified transcriptional coactivator essential for ligand-dependent transactivation by nuclear receptors in vivo. (PMID: 10567404) Lee SK … Lee JW (The Journal of biological chemistry 1999) 3 4 22 58
- Evidence for functional interaction between the HIV-1 Tat transactivator and the TATA box binding protein in vivo. (PMID: 7608968) Veschambre P … Jalinot P (Journal of molecular biology 1995) 3 4 22 58
Products for TBP Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Human Proteins and Enzymes
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for TBP
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for TBP
- Search Origene for MassSpec and Protein Over-expression Lysates for TBP
- Origene Custom Protein Services for TBP
- Origene shrna, sirna, and RNAi products in human, mouse, rat for TBP
- Browse OriGene Inhibitory RNA Products For TBP
- OriGene qPCR primer pairs and template standards for TBP
- OriGene qPCR primer pairs for TBP
- OriGene CRISPR knockouts for TBP
- OriGene ORF clones in human for TBP
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For TBP
- GenScript: Next-day shipping of latest version cDNA ORF clones for TBP in any vector
- GenScript Custom Purified and Recombinant Proteins Services for TBP
- GenScript Custom Assay Services for TBP
- GenScript Custom overexpressing Cell Line Services for TBP
- GenScript: Design CRISPR guide RNA sequences for TBP
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for TBP
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Sino Biological Antibodies for TBP
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals Antibodies for TBP
- Novus Biologicals lysates and proteins for TBP
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for TBP
- Abcam proteins for TBP
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Browse Antibodies at Cloud-Clone Corp.
- Cloud-Clone Corp. Proteins for TBP
- Browse Assay Kits at Cloud-Clone Corp.
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Cyagen custom Knockout/knockin (KOKI) mouse models for TBP
- VectorBuilder custom plasmid, inducible vectors for TBP
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for TBP
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for TBP
- antibodies-online: Search results for 143 available TBP Antibodies ranked by validation data
- Compare Top TBP Antibodies
- antibodies-online: Search results for 25 available TBP Elisa Kits ranked by validation data
- Compare Top TBP Elisa Kits
- antibodies-online: Search results for 35 available TBP Proteins ranked by validation data
- Compare Top TBP Proteins
- GeneTex TBP antibody for TBP
- Search GeneTex for Proteins for TBP
- ViGene Biosciences adenoviral particle packaged cDNA for TBP gene
- ViGene Biosciences lentiviral particle packaged cDNA for TBP gene
- ViGene Biosciences ready-to-package AAV shRNAs for TBP gene
- Search ViGene Biosciences for TBP
- Santa Cruz Biotechnology (SCBT) Antibodies for TBP
- Search Santa Cruz Biotechnology (SCBT) for TBP siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for TBP
- Horizon Cell Lines for TBP
- genomics-online: cdna clones - Search results for 115 available TBP gene related products
- Overview of 115 available TBP gene related products
- orf clones - Search results for 115 available TBP gene related products
- Overview of 115 available TBP gene related products
- genomics-online: gRNA clones - Search results for 115 available TBP gene related products
- Overview of 115 available TBP gene related products
- genomics-online: primer clones - Search results for 115 available TBP gene related products
- Overview of 115 available TBP gene related products
- genomics-online: shRNA clones - Search results for 115 available TBP gene related products
- Overview of 115 available TBP gene related products
Sources for TBP Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84)