Free for academic non-profit institutions. Other users need a Commercial license

Aliases for TBC1D16 Gene

Aliases for TBC1D16 Gene

  • TBC1 Domain Family Member 16 2 3 5
  • TBC1 Domain Family, Member 16 2
  • CTD-2529O21.1 3

External Ids for TBC1D16 Gene

Previous GeneCards Identifiers for TBC1D16 Gene

  • GC17M078609
  • GC17M078611
  • GC17M075513
  • GC17M077913
  • GC17M073354
  • GC17M077907

Summaries for TBC1D16 Gene

GeneCards Summary for TBC1D16 Gene

TBC1D16 (TBC1 Domain Family Member 16) is a Protein Coding gene. Among its related pathways are Vesicle-mediated transport and TBC/RABGAPs. Gene Ontology (GO) annotations related to this gene include GTPase activator activity. An important paralog of this gene is TBC1D17.

UniProtKB/Swiss-Prot for TBC1D16 Gene

  • May act as a GTPase-activating protein for Rab family protein(s).

Additional gene information for TBC1D16 Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for TBC1D16 Gene

Genomics for TBC1D16 Gene

GeneHancer (GH) Regulatory Elements for TBC1D16 Gene

Promoters and enhancers for TBC1D16 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH17I080034 Promoter/Enhancer 2.2 EPDnew FANTOM5 Ensembl ENCODE 566.5 -0.2 -227 2.8 FOXA2 ZFP64 ARID4B SIN3A DMAP1 ZNF2 YY1 SLC30A9 KLF13 SP3 CCDC40 TBC1D16 GAA
GH17I079948 Promoter/Enhancer 1.6 EPDnew Ensembl ENCODE dbSUPER 550.2 +84.8 84815 5.2 BCOR RING1 SOX13 MXI1 ESRRA PKNOX1 ZMYM3 ZIC2 TEAD3 ZFHX2 ENSG00000275516 TBC1D16 LOC100294362 ENDOV CBX4 CBX2 CCDC40 PIR49167 GC17P079941
GH17I079984 Promoter/Enhancer 2.3 FANTOM5 Ensembl ENCODE dbSUPER 12 +45.8 45810 11.1 HDGF PKNOX1 CLOCK FOXA2 MLX ZFP64 ARID4B SIN3A FEZF1 DMAP1 EIF4A3 CCDC40 ENGASE CBX2 TBC1D16 LOC100294362 ENDOV SGSH CANT1 ENSG00000262580
GH17I080453 Promoter/Enhancer 2 FANTOM5 Ensembl ENCODE 11.5 -419.9 -419927 5 HDGF PKNOX1 ZFP64 ARID4B SIN3A DMAP1 ZNF2 SLC30A9 POLR2B ZNF766 ENSG00000260369 CEP131 TEPSIN TBC1D16 LOC105371925 CBX8 NPTX1 EIF4A3 SGSH GAA
GH17I080068 Enhancer 1.1 Ensembl ENCODE 12.6 -34.4 -34350 3.8 PKNOX1 FOXA2 ZFP64 ARID4B DMAP1 ZNF48 YY1 ZNF121 FOS ATF7 EIF4A3 GAA CCDC40 TBC1D16 CBX2 GC17P080040 MIR1268B
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around TBC1D16 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the TBC1D16 gene promoter:

Genomic Locations for TBC1D16 Gene

Genomic Locations for TBC1D16 Gene
103,525 bases
Minus strand

Genomic View for TBC1D16 Gene

Genes around TBC1D16 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
TBC1D16 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for TBC1D16 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for TBC1D16 Gene

Proteins for TBC1D16 Gene

  • Protein details for TBC1D16 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    TBC1 domain family member 16
    Protein Accession:
    Secondary Accessions:
    • B9A6L7
    • I3L1E0
    • I3L4U2
    • Q8N3Z4
    • Q96DH7

    Protein attributes for TBC1D16 Gene

    767 amino acids
    Molecular mass:
    86372 Da
    Quaternary structure:
    No Data Available
    • Sequence=AAH01525.2; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};

    Alternative splice isoforms for TBC1D16 Gene


neXtProt entry for TBC1D16 Gene

Post-translational modifications for TBC1D16 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for TBC1D16 Gene

Domains & Families for TBC1D16 Gene

Gene Families for TBC1D16 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for TBC1D16 Gene

Suggested Antigen Peptide Sequences for TBC1D16 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with TBC1D16: view

No data available for UniProtKB/Swiss-Prot for TBC1D16 Gene

Function for TBC1D16 Gene

Molecular function for TBC1D16 Gene

UniProtKB/Swiss-Prot Function:
May act as a GTPase-activating protein for Rab family protein(s).

Gene Ontology (GO) - Molecular Function for TBC1D16 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005096 GTPase activator activity IEA,IDA 23019362
GO:0005515 protein binding IPI 22354992
GO:0017137 Rab GTPase binding IBA --
genes like me logo Genes that share ontologies with TBC1D16: view
genes like me logo Genes that share phenotypes with TBC1D16: view

Clone Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for TBC1D16 Gene

Localization for TBC1D16 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for TBC1D16 gene
Compartment Confidence
cytosol 5
endosome 5
mitochondrion 2
nucleus 2
endoplasmic reticulum 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Intermediate filaments (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for TBC1D16 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005769 early endosome IDA 23019362
GO:0005829 cytosol IDA 23019362
genes like me logo Genes that share ontologies with TBC1D16: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for TBC1D16 Gene

Pathways & Interactions for TBC1D16 Gene

genes like me logo Genes that share pathways with TBC1D16: view

Pathways by source for TBC1D16 Gene

3 Reactome pathways for TBC1D16 Gene

Gene Ontology (GO) - Biological Process for TBC1D16 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001919 regulation of receptor recycling IDA 23019362
GO:0006886 intracellular protein transport IBA --
GO:0031338 regulation of vesicle fusion IBA --
GO:0090630 activation of GTPase activity IBA --
GO:1902017 NOT regulation of cilium assembly IMP 17646400
genes like me logo Genes that share ontologies with TBC1D16: view

No data available for SIGNOR curated interactions for TBC1D16 Gene

Drugs & Compounds for TBC1D16 Gene

No Compound Related Data Available

Transcripts for TBC1D16 Gene

Unigene Clusters for TBC1D16 Gene

TBC1 domain family, member 16:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for TBC1D16 Gene

ExUns: 1a · 1b ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9a · 9b ^ 10a · 10b ^ 11 ^ 12a · 12b ^ 13 ^ 14 ^ 15 ^ 16a · 16b
SP1: - - - -
SP2: - -
SP3: -
SP4: -
SP6: -

Relevant External Links for TBC1D16 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for TBC1D16 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for TBC1D16 Gene

Protein differential expression in normal tissues from HIPED for TBC1D16 Gene

This gene is overexpressed in Adipocyte (68.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for TBC1D16 Gene

Protein tissue co-expression partners for TBC1D16 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of TBC1D16 Gene:


SOURCE GeneReport for Unigene cluster for TBC1D16 Gene:


Evidence on tissue expression from TISSUES for TBC1D16 Gene

  • Nervous system(4.6)
  • Skin(4)
genes like me logo Genes that share expression patterns with TBC1D16: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for TBC1D16 Gene

Orthologs for TBC1D16 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for TBC1D16 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia TBC1D16 33 34
  • 99.35 (n)
(Canis familiaris)
Mammalia TBC1D16 33 34
  • 88.39 (n)
(Bos Taurus)
Mammalia TBC1D16 33 34
  • 86.74 (n)
(Mus musculus)
Mammalia Tbc1d16 33 16 34
  • 84.73 (n)
(Rattus norvegicus)
Mammalia Tbc1d16 33
  • 84.64 (n)
(Monodelphis domestica)
Mammalia TBC1D16 34
  • 82 (a)
(Ornithorhynchus anatinus)
Mammalia TBC1D16 34
  • 65 (a)
(Gallus gallus)
Aves TBC1D16 33 34
  • 77.41 (n)
(Anolis carolinensis)
Reptilia TBC1D16 34
  • 76 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia tbc1d16 33
  • 68.62 (n)
Str.5438 33
African clawed frog
(Xenopus laevis)
Amphibia MGC68883 33
(Danio rerio)
Actinopterygii tbc1d16 33 34
  • 72.37 (n)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.2556 33
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP011218 33
  • 64.13 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG5337 33 34
  • 56.51 (n)
(Caenorhabditis elegans)
Secernentea tbc-16 33 34
  • 50.03 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes GYP7 34
  • 17 (a)
Species where no ortholog for TBC1D16 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for TBC1D16 Gene

Gene Tree for TBC1D16 (if available)
Gene Tree for TBC1D16 (if available)

Paralogs for TBC1D16 Gene

Paralogs for TBC1D16 Gene

genes like me logo Genes that share paralogs with TBC1D16: view

Variants for TBC1D16 Gene

Sequence variations from dbSNP and Humsavar for TBC1D16 Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs73437681 benign, likely-benign, not specified, Primary ciliary dyskinesia 80,036,627(-) C/G/T upstream_transcript_variant
rs771732758 uncertain-significance, Primary ciliary dyskinesia 80,036,685(-) CGGGCCGGTAAGCCGGGCCG/CGGGCCGGTAAGCCGGGCCGGTAAGCCGGGCCG upstream_transcript_variant
rs3752042 benign, not specified 80,036,614(-) C/A upstream_transcript_variant
rs1000032390 -- 80,020,020(-) G/A genic_upstream_transcript_variant, intron_variant
rs1000043338 -- 79,986,553(-) C/G genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for TBC1D16 Gene

Variant ID Type Subtype PubMed ID
dgv572e199 CNV deletion 23128226
esv2210925 CNV deletion 18987734
esv2642422 CNV insertion 19546169
esv2666144 CNV deletion 23128226
esv2671544 CNV deletion 23128226
esv2716353 CNV deletion 23290073
esv2716354 CNV deletion 23290073
esv2716355 CNV deletion 23290073
esv29117 CNV loss 19812545
esv3554847 CNV deletion 23714750
esv3641358 CNV loss 21293372
esv3641359 CNV loss 21293372
nsv1066606 CNV gain 25217958
nsv1117186 CNV tandem duplication 24896259
nsv1133414 CNV deletion 24896259
nsv469865 CNV loss 16826518
nsv470615 CNV loss 18288195
nsv517686 CNV loss 19592680
nsv520743 CNV gain 19592680
nsv527410 CNV loss 19592680
nsv576128 CNV gain 21841781
nsv828121 CNV loss 20364138
nsv833561 CNV loss 17160897
nsv960212 CNV deletion 23825009

Variation tolerance for TBC1D16 Gene

Residual Variation Intolerance Score: 45.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.26; 52.75% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for TBC1D16 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for TBC1D16 Gene

Disorders for TBC1D16 Gene

Additional Disease Information for TBC1D16

No disorders were found for TBC1D16 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for TBC1D16 Gene

Publications for TBC1D16 Gene

  1. TBC1D16 is a Rab4A GTPase activating protein that regulates receptor recycling and EGF receptor signaling. (PMID: 23019362) Goueli BS … Pfeffer SR (Proceedings of the National Academy of Sciences of the United States of America 2012) 2 3 58
  2. Identification and characterization of a novel Tre-2/Bub2/Cdc16 (TBC) protein that possesses Rab3A-GAP activity. (PMID: 19077034) Ishibashi K … Fukuda M (Genes to cells : devoted to molecular & cellular mechanisms 2009) 3 4 58
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
  4. Investigation of correlations between DNA methylation, suicidal behavior and aging. (PMID: 28276657) Jeremian R … Strauss J (Bipolar disorders 2017) 3 58
  5. A human interactome in three quantitative dimensions organized by stoichiometries and abundances. (PMID: 26496610) Hein MY … Mann M (Cell 2015) 3 58

Products for TBC1D16 Gene

Sources for TBC1D16 Gene

Loading form....