Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SVOPL Gene

Aliases for SVOPL Gene

  • SVOP Like 2 3 5
  • SV2 Related Protein Homolog (Rat)-Like 2
  • SV2-Related Protein-Like 4
  • SVOP-Like Protein 4
  • SVOP-Like 2

External Ids for SVOPL Gene

Previous GeneCards Identifiers for SVOPL Gene

  • GC07M137930
  • GC07M138279
  • GC07M132588

Summaries for SVOPL Gene

Entrez Gene Summary for SVOPL Gene

  • The protein encoded by this gene is thought to be a member of solute carrier family 22, which includes transmembrane proteins that transport toxins and drugs from the body. This gene is a paralog of the SVOP gene that encodes synaptic vesicle 2-related protein. [provided by RefSeq, Sep 2016]

GeneCards Summary for SVOPL Gene

SVOPL (SVOP Like) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include transmembrane transporter activity. An important paralog of this gene is SVOP.

Additional gene information for SVOPL Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SVOPL Gene

Genomics for SVOPL Gene

GeneHancer (GH) Regulatory Elements for SVOPL Gene

Promoters and enhancers for SVOPL Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH07I138661 Promoter/Enhancer 1.8 EPDnew Ensembl ENCODE 550.3 +37.0 36979 5.5 HDGF ELF3 PKNOX1 FOXA2 RARA ZNF335 RCOR1 KLF7 CEBPB REST SVOPL RPL21P73 RPL17P27
GH07I138738 Enhancer 1.1 Ensembl ENCODE 10.8 -37.5 -37537 1.2 RB1 ARNT ZNF133 ARID4B ZNF2 IRF4 RAD21 RFX5 YY1 ARID2 SVOPL UQCRFS1P2 ENSG00000201465 TMEM213 ATP6V0A4
GH07I138472 Enhancer 0.8 ENCODE dbSUPER 10.7 +228.8 228787 0.5 TFAP4 FOXA2 SAP130 ZNF384 RARA SSRP1 POLR2A PRDM1 SUPT5H SVOPL ENSG00000201465 UQCRFS1P2 TRIM24 RPS3AP28
GH07I138613 Enhancer 0.7 ENCODE 10.4 +87.0 86951 1 SOX13 ATF1 FOXA2 ZNF384 CEBPG RARA ZNF316 TRIM24 NFIA FOXA3 SVOPL UQCRFS1P2 ENSG00000252188 GC07M138626 RPS3AP28
GH07I138746 Enhancer 0.6 FANTOM5 11.8 -44.9 -44934 0.3 PKNOX1 ZNF316 POLR2A MAFG NFE2 MAFK EMSY SVOPL UQCRFS1P2 ATP6V0A4 TMEM213
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SVOPL on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SVOPL gene promoter:

Genomic Locations for SVOPL Gene

Genomic Locations for SVOPL Gene
107,070 bases
Minus strand

Genomic View for SVOPL Gene

Genes around SVOPL on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SVOPL Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SVOPL Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SVOPL Gene

Proteins for SVOPL Gene

  • Protein details for SVOPL Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Putative transporter SVOPL
    Protein Accession:

    Protein attributes for SVOPL Gene

    492 amino acids
    Molecular mass:
    53991 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for SVOPL Gene


neXtProt entry for SVOPL Gene

Post-translational modifications for SVOPL Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for SVOPL Gene

Domains & Families for SVOPL Gene

Gene Families for SVOPL Gene

Human Protein Atlas (HPA):
  • Predicted membrane proteins

Protein Domains for SVOPL Gene

Suggested Antigen Peptide Sequences for SVOPL Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the major facilitator superfamily.
  • Belongs to the major facilitator superfamily.
genes like me logo Genes that share domains with SVOPL: view

Function for SVOPL Gene

Phenotypes From GWAS Catalog for SVOPL Gene

Gene Ontology (GO) - Molecular Function for SVOPL Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0022857 transmembrane transporter activity IEA --
genes like me logo Genes that share ontologies with SVOPL: view
genes like me logo Genes that share phenotypes with SVOPL: view

Animal Model Products

  • Taconic Biosciences Mouse Models for SVOPL

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for SVOPL Gene

Localization for SVOPL Gene

Subcellular locations from UniProtKB/Swiss-Prot for SVOPL Gene

Membrane; Multi-pass membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SVOPL gene
Compartment Confidence
plasma membrane 3

Gene Ontology (GO) - Cellular Components for SVOPL Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IBA --
genes like me logo Genes that share ontologies with SVOPL: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for SVOPL Gene

Pathways & Interactions for SVOPL Gene

SuperPathways for SVOPL Gene

No Data Available

Interacting Proteins for SVOPL Gene

STRING Interaction Network Preview (showing 1 interactants - click image to see details)
Selected Interacting proteins: Q8N434-SVOPL_HUMAN ENSP00000405482 for SVOPL Gene via IID STRING

Gene Ontology (GO) - Biological Process for SVOPL Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0055085 transmembrane transport IEA --
genes like me logo Genes that share ontologies with SVOPL: view

No data available for Pathways by source and SIGNOR curated interactions for SVOPL Gene

Drugs & Compounds for SVOPL Gene

No Compound Related Data Available

Transcripts for SVOPL Gene

mRNA/cDNA for SVOPL Gene

Unigene Clusters for SVOPL Gene

Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for SVOPL Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11a · 11b ^ 12
SP1: - -

Relevant External Links for SVOPL Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SVOPL Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SVOPL Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for SVOPL Gene

This gene is overexpressed in Testis (x8.2) and Kidney - Cortex (x7.8).

NURSA nuclear receptor signaling pathways regulating expression of SVOPL Gene:


SOURCE GeneReport for Unigene cluster for SVOPL Gene:

genes like me logo Genes that share expression patterns with SVOPL: view

No data available for Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for SVOPL Gene

Orthologs for SVOPL Gene

This gene was present in the common ancestor of chordates.

Orthologs for SVOPL Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia SVOPL 33 34
  • 99.32 (n)
(Monodelphis domestica)
Mammalia SVOPL 34
  • 90 (a)
(Bos Taurus)
Mammalia SVOPL 33 34
  • 88.89 (n)
(Canis familiaris)
Mammalia SVOPL 33 34
  • 88.07 (n)
(Mus musculus)
Mammalia Svopl 33 16 34
  • 87.53 (n)
(Rattus norvegicus)
Mammalia RGD1566053 33
  • 84.66 (n)
(Ornithorhynchus anatinus)
Mammalia SVOPL 34
  • 66 (a)
(Gallus gallus)
Aves SVOPL 33 34
  • 76.94 (n)
(Anolis carolinensis)
Reptilia SVOPL 34
  • 78 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia svopl 33
  • 69.74 (n)
(Danio rerio)
Actinopterygii svopl 33 34
  • 60 (n)
Species where no ortholog for SVOPL was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for SVOPL Gene

Gene Tree for SVOPL (if available)
Gene Tree for SVOPL (if available)

Paralogs for SVOPL Gene

Paralogs for SVOPL Gene

(2) SIMAP similar genes for SVOPL Gene using alignment to 3 proteins:

genes like me logo Genes that share paralogs with SVOPL: view

Variants for SVOPL Gene

Sequence variations from dbSNP and Humsavar for SVOPL Gene

SNP ID Clin Chr 07 pos Variation AA Info Type
rs1000006050 -- 138,632,727(-) GGATGGGGGCGG/GGATGGGGGCGGATGGGGGCGG intron_variant
rs1000019503 -- 138,642,016(-) C/T intron_variant
rs1000044598 -- 138,670,063(-) C/T genic_upstream_transcript_variant, intron_variant
rs1000044720 -- 138,626,241(-) G/A intron_variant
rs1000050144 -- 138,676,905(-) T/A genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for SVOPL Gene

Variant ID Type Subtype PubMed ID
esv1010083 CNV deletion 20482838
esv1471021 CNV deletion 17803354
esv2543778 CNV deletion 19546169
esv2657210 CNV deletion 23128226
esv2659373 CNV deletion 23128226
esv2678647 CNV deletion 23128226
esv2735212 CNV deletion 23290073
esv2735218 CNV deletion 23290073
esv2735219 CNV deletion 23290073
esv2735220 CNV deletion 23290073
esv2735221 CNV deletion 23290073
esv2735222 CNV deletion 23290073
esv3359 CNV loss 18987735
esv3438653 CNV duplication 20981092
esv3542504 CNV deletion 23714750
esv3542505 CNV deletion 23714750
esv3542506 CNV deletion 23714750
esv3542507 CNV deletion 23714750
esv3615196 CNV loss 21293372
esv3615197 CNV loss 21293372
esv6486 CNV loss 19470904
esv7121 CNV loss 19470904
esv993410 CNV deletion 20482838
nsv1030956 CNV gain 25217958
nsv1076002 CNV deletion 25765185
nsv1076954 CNV deletion 25765185
nsv1109920 CNV deletion 24896259
nsv1112160 CNV deletion 24896259
nsv1119138 CNV deletion 24896259
nsv1120922 CNV deletion 24896259
nsv1140852 CNV deletion 24896259
nsv365934 CNV deletion 16902084
nsv512927 CNV insertion 21212237
nsv512928 CNV insertion 21212237
nsv5968 CNV insertion 18451855
nsv956979 CNV deletion 24416366
nsv970584 CNV duplication 23825009

Variation tolerance for SVOPL Gene

Residual Variation Intolerance Score: 97.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 14.47; 96.43% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for SVOPL Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SVOPL Gene

Disorders for SVOPL Gene

Additional Disease Information for SVOPL

No disorders were found for SVOPL Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SVOPL Gene

Publications for SVOPL Gene

  1. Identification of six putative human transporters with structural similarity to the drug transporter SLC22 family. (PMID: 17714910) Jacobsson JA … Fredriksson R (Genomics 2007) 3 4 58
  2. Mapping the NPHP-JBTS-MKS protein network reveals ciliopathy disease genes and pathways. (PMID: 21565611) Sang L … Jackson PK (Cell 2011) 3 58
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 4 58
  4. The DNA sequence of human chromosome 7. (PMID: 12853948) Hillier LW … Wilson RK (Nature 2003) 4 58
  5. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg RL … Mammalian Gene Collection Program Team (Proceedings of the National Academy of Sciences of the United States of America 2002) 3 58

Products for SVOPL Gene

Sources for SVOPL Gene

Loading form....