Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR2 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in cere... See more...

Aliases for SSTR2 Gene

Aliases for SSTR2 Gene

  • Somatostatin Receptor 2 2 3 5
  • Somatostatin Receptor Type 2 3 4
  • SRIF-1 3 4
  • SS2R 3 4
  • SS-2-R 4
  • SS2-R 4

External Ids for SSTR2 Gene

Previous GeneCards Identifiers for SSTR2 Gene

  • GC17P071046
  • GC17P074201
  • GC17P071625
  • GC17P071758
  • GC17P068672
  • GC17P071161
  • GC17P066570

Summaries for SSTR2 Gene

Entrez Gene Summary for SSTR2 Gene

  • Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR2 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in cerebrum and kidney. [provided by RefSeq, Jul 2008]

GeneCards Summary for SSTR2 Gene

SSTR2 (Somatostatin Receptor 2) is a Protein Coding gene. Diseases associated with SSTR2 include Neuroendocrine Tumor and Growth Hormone Secreting Pituitary Adenoma. Among its related pathways are GPCRs, Other and Peptide ligand-binding receptors. Gene Ontology (GO) annotations related to this gene include G protein-coupled receptor activity and neuropeptide binding. An important paralog of this gene is SSTR5.

UniProtKB/Swiss-Prot Summary for SSTR2 Gene

  • Receptor for somatostatin-14 and -28. This receptor is coupled via pertussis toxin sensitive G proteins to inhibition of adenylyl cyclase. In addition it stimulates phosphotyrosine phosphatase and PLC via pertussis toxin insensitive as well as sensitive G proteins. Inhibits calcium entry by suppressing voltage-dependent calcium channels. Acts as the functionally dominant somatostatin receptor in pancreatic alpha- and beta-cells where it mediates the inhibitory effect of somatostatin-14 on hormone secretion. Inhibits cell growth through enhancement of MAPK1 and MAPK2 phosphorylation and subsequent up-regulation of CDKN1B. Stimulates neuronal migration and axon outgrowth and may participate in neuron development and maturation during brain development. Mediates negative regulation of insulin receptor signaling through PTPN6. Inactivates SSTR3 receptor function following heterodimerization.

Tocris Summary for SSTR2 Gene

  • Somatostatin (somatotropin release inhibiting factor, SRIF) is an endogenous cyclic polypeptide with two biologically active forms. It is an abundant neuropeptide and has a wide range of physiological effects on neurotransmission, secretion and cell proliferation.

Gene Wiki entry for SSTR2 Gene

Additional gene information for SSTR2 Gene

No data available for CIViC Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for SSTR2 Gene

Genomics for SSTR2 Gene

GeneHancer (GH) Regulatory Elements for SSTR2 Gene

Promoters and enhancers for SSTR2 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around SSTR2 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SSTR2 gene promoter:
  • AML1a
  • AP-1
  • En-1
  • ER-alpha
  • GATA-2
  • MyoD
  • NF-kappaB
  • NF-kappaB1
  • Pbx1a
  • ZIC2

Genomic Locations for SSTR2 Gene

Genomic Locations for SSTR2 Gene
11,624 bases
Plus strand
6,944 bases
Plus strand

Genomic View for SSTR2 Gene

Genes around SSTR2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SSTR2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SSTR2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SSTR2 Gene

Proteins for SSTR2 Gene

  • Protein details for SSTR2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Somatostatin receptor type 2
    Protein Accession:
    Secondary Accessions:
    • A8K3Y0
    • B2R9P7
    • Q4VBP0
    • Q96GE0
    • Q96TF2
    • Q9BWH1

    Protein attributes for SSTR2 Gene

    369 amino acids
    Molecular mass:
    41333 Da
    Quaternary structure:
    • Homodimer and heterodimer with SSTR3 and SSTR5. Heterodimerization with SSTR3 inactivates SSTR3 receptor function. Heterodimerization with SSTR5 is enhanced by agonist stimulation of SSTR2 and increases SSTR2 cell growth inhibition activity. Following agonist stimulation, homodimers dissociate into monomers which is required for receptor internalization. Interacts with beta-arrestin; this interaction is necessary for receptor internalization and is destabilized by heterodimerization with SSTR5 which results in increased recycling of SSTR2 to the cell surface. Interacts (via C-terminus) with SHANK1 (via PDZ domain).

    Alternative splice isoforms for SSTR2 Gene


neXtProt entry for SSTR2 Gene

Post-translational modifications for SSTR2 Gene

  • Phosphorylated on serine and threonine residues in response to agonist stimulation, leading to receptor desensitization and rapid internalization. Phosphorylated to a greater extent on serine than threonine residues. Threonine phosphorylation is required for arrestin binding and receptor endocytosis but is not necessary for desensitization (By similarity).
  • Glycosylation at Asn9, Asn22, Asn29, and Asn32
  • Modification sites at PhosphoSitePlus

Other Protein References for SSTR2 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • Santa Cruz Biotechnology (SCBT) Antibodies for SSTR2

No data available for DME Specific Peptides for SSTR2 Gene

Domains & Families for SSTR2 Gene

Gene Families for SSTR2 Gene

Human Protein Atlas (HPA):
  • FDA approved drug targets
  • G-protein coupled receptors
  • Predicted membrane proteins

Suggested Antigen Peptide Sequences for SSTR2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the G-protein coupled receptor 1 family.
  • Belongs to the G-protein coupled receptor 1 family.
genes like me logo Genes that share domains with SSTR2: view

Function for SSTR2 Gene

Molecular function for SSTR2 Gene

UniProtKB/Swiss-Prot Function:
Receptor for somatostatin-14 and -28. This receptor is coupled via pertussis toxin sensitive G proteins to inhibition of adenylyl cyclase. In addition it stimulates phosphotyrosine phosphatase and PLC via pertussis toxin insensitive as well as sensitive G proteins. Inhibits calcium entry by suppressing voltage-dependent calcium channels. Acts as the functionally dominant somatostatin receptor in pancreatic alpha- and beta-cells where it mediates the inhibitory effect of somatostatin-14 on hormone secretion. Inhibits cell growth through enhancement of MAPK1 and MAPK2 phosphorylation and subsequent up-regulation of CDKN1B. Stimulates neuronal migration and axon outgrowth and may participate in neuron development and maturation during brain development. Mediates negative regulation of insulin receptor signaling through PTPN6. Inactivates SSTR3 receptor function following heterodimerization.
GENATLAS Biochemistry:
somatostatin receptor gene 2,G protein coupled receptor superfamily

Phenotypes From GWAS Catalog for SSTR2 Gene

Gene Ontology (GO) - Molecular Function for SSTR2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004930 G protein-coupled receptor activity IBA 21873635
GO:0004994 somatostatin receptor activity IBA,TAS 21873635
GO:0005515 protein binding IPI 10551867
GO:0030165 PDZ domain binding IPI,IEA 10551867
GO:0042277 peptide binding IBA 21873635
genes like me logo Genes that share ontologies with SSTR2: view
genes like me logo Genes that share phenotypes with SSTR2: view

Animal Models for SSTR2 Gene

MGI Knock Outs for SSTR2:

Animal Model Products

CRISPR Products

miRNA for SSTR2 Gene

miRTarBase miRNAs that target SSTR2

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for SSTR2

Clone Products

  • Addgene plasmids for SSTR2

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for SSTR2 Gene

Localization for SSTR2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SSTR2 Gene

Cell membrane; Multi-pass membrane protein. Cytoplasm. Note=Located mainly at the cell surface under basal conditions. Agonist stimulation results in internalization to the cytoplasm.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SSTR2 gene
Compartment Confidence
plasma membrane 5
cytosol 4
nucleus 2
extracellular 1
cytoskeleton 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for SSTR2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA --
GO:0005829 cytosol IDA --
GO:0005886 plasma membrane TAS --
GO:0005887 integral component of plasma membrane TAS,IBA 21873635
GO:0016020 membrane IEA --
genes like me logo Genes that share ontologies with SSTR2: view

Pathways & Interactions for SSTR2 Gene

genes like me logo Genes that share pathways with SSTR2: view

SIGNOR curated interactions for SSTR2 Gene


Gene Ontology (GO) - Biological Process for SSTR2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006937 regulation of muscle contraction IEA --
GO:0007165 signal transduction IEA --
GO:0007186 G protein-coupled receptor signaling pathway TAS --
GO:0007187 G protein-coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger TAS 7914078
GO:0007193 adenylate cyclase-inhibiting G protein-coupled receptor signaling pathway IEA --
genes like me logo Genes that share ontologies with SSTR2: view

Drugs & Compounds for SSTR2 Gene

(96) Drugs for SSTR2 Gene - From: DrugBank, ClinicalTrials, ApexBio, DGIdb, IUPHAR, HMDB, Tocris, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Octreotide Approved, Investigational Pharma Full agonist, Agonist, Target, binder sst2, sst3 and sst5 agonist 267
lanreotide Approved Pharma Full agonist, Agonist, Target, agonist 97
Pasireotide Approved Pharma Target, inhibitor, agonist 76
Somatostatin Approved, Investigational Pharma Target, agonist Influences growth hormone release 289
Calcium Approved Nutra 7773

(20) Additional Compounds for SSTR2 Gene - From: IUPHAR and Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
analog 3
analog 30
analog 31
Full agonist, Agonist
Full agonist, Agonist

(5) Tocris Compounds for SSTR2 Gene

Compound Action Cas Number
Cortistatin 14 Endogenous neuropeptide; binds sst1 - sst5 and ghrelin receptor 193829-96-8
Octreotide sst2, sst3 and sst5 agonist 83150-76-9
Seglitide sst2 and sst5 agonist 81377-02-8
Somatostatin Influences growth hormone release 51110-01-1
Somatostatin 1-28 sst receptor agonist 74315-46-1

(14) ApexBio Compounds for SSTR2 Gene

Compound Action Cas Number
(1R,1'S,3'R/1R,1'R,3'S)-L-054,264 208706-12-1
BIM 23052 sst5 receptor agonist 133073-82-2
BIM 23056 Somatostatin receptor ligand 150155-61-6
CH 275 174688-78-9
Cortistatin 14 193829-96-8
Cyclosomatostatin somatostatin receptor antagonist 84211-54-1
CYN 154806 183658-72-2
L-803,087 trifluoroacetate 217480-26-7
L-817,818 217480-27-8
NNC 26-9100 199522-35-5
Octreotide acetate octapeptide congener of native somatostatin 83150-76-9
Pasireotide 396091-73-9
Seglitide 81377-02-8
Somatostatin 1-28 74315-46-1
genes like me logo Genes that share compounds with SSTR2: view

Drug Products

Transcripts for SSTR2 Gene

mRNA/cDNA for SSTR2 Gene

(1) REFSEQ mRNAs :
(8) Additional mRNA sequences :
(66) Selected AceView cDNA sequences:
(2) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

CRISPR Products

Inhibitory RNA Products

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for SSTR2

Clone Products

  • Addgene plasmids for SSTR2

Alternative Splicing Database (ASD) splice patterns (SP) for SSTR2 Gene

ExUns: 1a · 1b ^ 2 ^ 3a · 3b
SP2: -

Relevant External Links for SSTR2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SSTR2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SSTR2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for SSTR2 Gene

This gene is overexpressed in Brain - Cerebellar Hemisphere (x5.9), Brain - Cerebellum (x4.8), and Brain - Anterior cingulate cortex (BA24) (x4.1).

Protein differential expression in normal tissues from HIPED for SSTR2 Gene

This gene is overexpressed in Cerebral cortex (61.4) and Retina (6.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for SSTR2 Gene

Protein tissue co-expression partners for SSTR2 Gene

NURSA nuclear receptor signaling pathways regulating expression of SSTR2 Gene:


SOURCE GeneReport for Unigene cluster for SSTR2 Gene:


mRNA Expression by UniProt/SwissProt for SSTR2 Gene:

Tissue specificity: Expressed in both pancreatic alpha- and beta-cells (at protein level). Expressed at higher levels in the pancreas than other somatostatin receptors. Also expressed in the cerebrum and kidney and, in lesser amounts, in the jejunum, colon and liver. In the developing nervous system, expressed in the cortex where it is located in the preplate at early stages and is enriched in the outer part of the germinal zone at later stages. In the cerebellum, expressed in the deep part of the external granular layer at gestational week 19. This pattern persists until birth but disappears at adulthood.

Evidence on tissue expression from TISSUES for SSTR2 Gene

  • Eye(4.2)
  • Nervous system(4.2)
  • Pancreas(2.3)
  • Kidney(2.1)
  • Thyroid gland(2)
genes like me logo Genes that share expression patterns with SSTR2: view

No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for SSTR2 Gene

Orthologs for SSTR2 Gene

This gene was present in the common ancestor of animals.

Orthologs for SSTR2 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia SSTR2 33 32
  • 99.64 (n)
(Canis familiaris)
Mammalia SSTR2 33 32
  • 93.04 (n)
(Bos Taurus)
Mammalia SSTR2 33 32
  • 92.12 (n)
(Monodelphis domestica)
Mammalia SSTR2 33
  • 91 (a)
(Mus musculus)
Mammalia Sstr2 17 33 32
  • 88.26 (n)
(Rattus norvegicus)
Mammalia Sstr2 32
  • 87.99 (n)
(Ornithorhynchus anatinus)
Mammalia SSTR2 33
  • 87 (a)
(Gallus gallus)
Aves SS2R 33
  • 88 (a)
SSTR2 32
  • 81.07 (n)
(Anolis carolinensis)
Reptilia SSTR2 33
  • 85 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia sstr2 32
  • 73.53 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.19621 32
(Danio rerio)
Actinopterygii LOC100333578 32
  • 66.67 (n)
SSTR2 (1 of 2) 33
  • 63 (a)
SSTR2 (2 of 2) 33
  • 61 (a)
fruit fly
(Drosophila melanogaster)
Insecta star1 32
  • 53.86 (n)
AlCR2 34
  • 41 (a)
Drostar1 34
  • 39 (a)
African malaria mosquito
(Anopheles gambiae)
Insecta GPRALS3 32
  • 52.07 (n)
(Caenorhabditis elegans)
Secernentea npr-24 32
  • 45.56 (n)
Species where no ortholog for SSTR2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for SSTR2 Gene

Gene Tree for SSTR2 (if available)
Gene Tree for SSTR2 (if available)
Evolutionary constrained regions (ECRs) for SSTR2: view image

Paralogs for SSTR2 Gene

Variants for SSTR2 Gene

Sequence variations from dbSNP and Humsavar for SSTR2 Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs1000010817 -- 73,165,519(+) TGTGGGTAGAGTGTG/TGTGGGTAGAGTGTGGGTAGAGTGTG intron_variant
rs1000234307 -- 73,170,732(+) G/T 3_prime_UTR_variant
rs1000446017 -- 73,176,354(+) C/A 3_prime_UTR_variant
rs1000497807 -- 73,163,931(+) G/T upstream_transcript_variant
rs1000656563 -- 73,164,411(+) G/A upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for SSTR2 Gene

Variant ID Type Subtype PubMed ID
nsv833534 CNV loss 17160897

Variation tolerance for SSTR2 Gene

Residual Variation Intolerance Score: 19.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.60; 12.84% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for SSTR2 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SSTR2 Gene

Disorders for SSTR2 Gene

MalaCards: The human disease database

(33) MalaCards diseases for SSTR2 Gene - From: HGMD, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
neuroendocrine tumor
  • neuroendocrine neoplasm
growth hormone secreting pituitary adenoma
  • growth hormone producing adenoma of the pituitary
pancreatic endocrine carcinoma
  • carcinoma of endocrine pancreas
type c thymoma
  • thymoma, type c
  • somatotroph adenoma
- elite association - COSMIC cancer census association via MalaCards
Search SSTR2 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for SSTR2

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with SSTR2: view

No data available for UniProtKB/Swiss-Prot and Genatlas for SSTR2 Gene

Publications for SSTR2 Gene

  1. Association of SSTR2 polymorphisms and glucose homeostasis phenotypes: the Insulin Resistance Atherosclerosis Family Study. (PMID: 19324939) Sutton BS … Bowden DW (Diabetes 2009) 3 23 43 56
  2. Cell growth inhibition and functioning of human somatostatin receptor type 2 are modulated by receptor heterodimerization. (PMID: 18653781) Grant M … Kumar U (Molecular endocrinology (Baltimore, Md.) 2008) 3 4 23 56
  3. Analysis of somatostatin receptors 2 and 5 polymorphisms in patients with acromegaly. (PMID: 15914528) Filopanti M … Spada A (The Journal of clinical endocrinology and metabolism 2005) 3 23 43 56
  4. Multiple gene transcripts of the somatostatin receptor SSTR2: tissue selective distribution and cAMP regulation. (PMID: 8386508) Patel YC … Srikant CB (Biochemical and biophysical research communications 1993) 3 4 23 56
  5. Cloning and functional characterization of a family of human and mouse somatostatin receptors expressed in brain, gastrointestinal tract, and kidney. (PMID: 1346068) Yamada Y … Seino S (Proceedings of the National Academy of Sciences of the United States of America 1992) 3 4 23 56

Products for SSTR2 Gene

Sources for SSTR2 Gene