Free for academic non-profit institutions. Other users need a Commercial license
The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants encoding the same protein and one non-coding transcript variant have been found for this gene. In addition, a pseudogene of this gene has been found on chromosome 11. [provided by RefSeq, Sep 2010]
SRSF2 (Serine And Arginine Rich Splicing Factor 2) is a Protein Coding gene. Diseases associated with SRSF2 include Systemic Mastocytosis With An Associated Clonal Hematologic Non-Mast Cell Lineage Disease and Chronic Neutrophilic Leukemia. Among its related pathways are Transport of Mature Transcript to Cytoplasm and Cleavage of Growing Transcript in the Termination Region. Gene Ontology (GO) annotations related to this gene include nucleic acid binding and nucleotide binding. An important paralog of this gene is SRSF8.
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0003676 | nucleic acid binding | IEA | -- |
GO:0003714 | transcription corepressor activity | NAS | 15652350 |
GO:0003723 | RNA binding | IEA,IBA | 21873635 |
GO:0005080 | protein kinase C binding | IEA | -- |
GO:0005515 | protein binding | IPI | 9237760 |
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0005634 | nucleus | IDA | 15652350 |
GO:0005654 | nucleoplasm | TAS | -- |
GO:0005681 | spliceosomal complex | IEA | -- |
GO:0005737 | cytoplasm | IBA | 21873635 |
GO:0005829 | cytosol | IDA | -- |
SuperPathway | Contained pathways | ||
---|---|---|---|
1 | mRNA Splicing - Major Pathway |
.79
|
.50
.41
|
2 | Cleavage of Growing Transcript in the Termination Region | ||
3 | Transport of Mature Transcript to Cytoplasm | ||
4 | Herpes simplex virus 1 infection | ||
5 | Gene Expression |
.48
|
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0000278 | mitotic cell cycle | IEA | -- |
GO:0000381 | regulation of alternative mRNA splicing, via spliceosome | IBA,IEA | 21873635 |
GO:0000398 | mRNA splicing, via spliceosome | TAS | -- |
GO:0006397 | mRNA processing | TAS | 8530103 |
GO:0006405 | RNA export from nucleus | TAS | -- |
ExUns: | 1a | · | 1b | ^ | 2a | · | 2b | ^ | 3a | · | 3b | · | 3c | ^ | 4 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
SP1: | |||||||||||||||
SP2: | - | - | |||||||||||||
SP3: | - | - |
This gene was present in the common ancestor of animals.
Organism | Taxonomy | Gene | Similarity | Type | Details |
---|---|---|---|---|---|
platypus (Ornithorhynchus anatinus) |
Mammalia | -- 33 |
|
OneToMany | |
dog (Canis familiaris) |
Mammalia | -- 33 |
|
OneToMany | |
SRSF2 32 |
|
||||
chimpanzee (Pan troglodytes) |
Mammalia | SRSF2 33 32 |
|
OneToOne | |
cow (Bos Taurus) |
Mammalia | SRSF2 33 32 |
|
OneToMany | |
rat (Rattus norvegicus) |
Mammalia | Srsf2 32 |
|
||
mouse (Mus musculus) |
Mammalia | Srsf2 17 33 32 |
|
||
oppossum (Monodelphis domestica) |
Mammalia | -- 33 |
|
OneToMany | |
chicken (Gallus gallus) |
Aves | SRSF2 33 32 |
|
OneToMany | |
lizard (Anolis carolinensis) |
Reptilia | -- 33 |
|
OneToMany | |
tropical clawed frog (Silurana tropicalis) |
Amphibia | MGC75633 32 |
|
||
zebrafish (Danio rerio) |
Actinopterygii | srsf2a 33 |
|
ManyToMany | |
srsf2b 33 |
|
ManyToMany | |||
Dr.8481 32 |
|
||||
rainbow trout (Oncorhynchus mykiss) |
Actinopterygii | Omy.3833 32 |
|
||
fruit fly (Drosophila melanogaster) |
Insecta | SC35 33 |
|
OneToMany | |
worm (Caenorhabditis elegans) |
Secernentea | rsp-4 33 |
|
OneToMany | |
sea squirt (Ciona savignyi) |
Ascidiacea | CSA.11125 33 |
|
OneToMany | |
Cin.3433 32 |
|
||||
sea squirt (Ciona intestinalis) |
Ascidiacea | Cin.3433 32 |
|
SNP ID | Clin | Chr 17 pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs1443221868 | uncertain-significance, Inborn genetic diseases | 76,733,617(-) | A/ | downstream_transcript_variant | |
rs757197161 | likely-pathogenic, not provided | 76,733,649(-) | AAATGCTGGT/AAATGCTGGTAAATGCTGGT | downstream_transcript_variant | |
rs147321492 | conflicting-interpretations-of-pathogenicity, not provided | 76,733,682(-) | T/C | downstream_transcript_variant | |
rs1064796272 | uncertain-significance, not provided | 76,736,272(-) | GGACCTGGACC/GGACC | coding_sequence_variant, inframe_deletion, non_coding_transcript_variant | |
rs1000409899 | -- | 76,736,096(-) | C/G | 3_prime_UTR_variant, intron_variant, non_coding_transcript_variant |
Disorder | Aliases | PubMed IDs |
---|---|---|
systemic mastocytosis with an associated clonal hematologic non-mast cell lineage disease |
|
|
chronic neutrophilic leukemia |
|
|
bestrophinopathy, autosomal recessive |
|
|
holt-oram syndrome |
|
|
systemic mastocytosis |
|
|