Free for academic non-profit institutions. Other users need a Commercial license
The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different ... See more...
Aliases for SRSF2 Gene
Aliases for SRSF2 Gene
External Ids for SRSF2 Gene
- HGNC: 10783
- Entrez Gene: 6427
- Ensembl: ENSG00000161547
- OMIM: 600813
- UniProtKB: Q01130
Previous HGNC Symbols for SRSF2 Gene
- SFRS2
Previous GeneCards Identifiers for SRSF2 Gene
- GC17M074731
- GC17M070157
Summaries for SRSF2 Gene
-
The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants encoding the same protein and one non-coding transcript variant have been found for this gene. In addition, a pseudogene of this gene has been found on chromosome 11. [provided by RefSeq, Sep 2010]
GeneCards Summary for SRSF2 Gene
SRSF2 (Serine And Arginine Rich Splicing Factor 2) is a Protein Coding gene. Diseases associated with SRSF2 include Systemic Mastocytosis With An Associated Clonal Hematologic Non-Mast Cell Lineage Disease and Chronic Neutrophilic Leukemia. Among its related pathways are Transport of Mature Transcript to Cytoplasm and Cleavage of Growing Transcript in the Termination Region. Gene Ontology (GO) annotations related to this gene include nucleic acid binding and nucleotide binding. An important paralog of this gene is SRSF8.
UniProtKB/Swiss-Prot Summary for SRSF2 Gene
-
Necessary for the splicing of pre-mRNA. It is required for formation of the earliest ATP-dependent splicing complex and interacts with spliceosomal components bound to both the 5'- and 3'-splice sites during spliceosome assembly. It also is required for ATP-dependent interactions of both U1 and U2 snRNPs with pre-mRNA. Interacts with other spliceosomal components, via the RS domains, to form a bridge between the 5'- and 3'-splice site binding components, U1 snRNP and U2AF. Binds to purine-rich RNA sequences, either 5'-AGSAGAGTA-3' (S=C or G) or 5'-GTTCGAGTA-3'. Can bind to beta-globin mRNA and commit it to the splicing pathway. The phosphorylated form (by SRPK2) is required for cellular apoptosis in response to cisplatin treatment.
No data available for Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for SRSF2 Gene
Genomics for SRSF2 Gene
GeneHancer (GH) Regulatory Elements for SRSF2 Gene
Promoters and enhancers for SRSF2 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication |
Request up-to-date GeneHancer data (full dataset)
GeneHancers around SRSF2 on UCSC Golden Path with GeneCards custom track
Genomic Locations for SRSF2 Gene
Genomic Locations for SRSF2 Gene
- chr17:76,734,115-76,737,629
- (GRCh38/hg38)
- Size:
- 3,515 bases
- Orientation:
- Minus strand
- chr17:74,730,197-74,733,493
- (GRCh37/hg19)
- Size:
- 3,297 bases
- Orientation:
- Minus strand
Genomic View for SRSF2 Gene
Genes around SRSF2 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 17q25.2 by HGNC
- 17q25.1 by Entrez Gene
- 17q25.1 by Ensembl
SRSF2 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for SRSF2 Gene
Proteins for SRSF2 Gene
-
Protein details for SRSF2 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q01130-SRSF2_HUMAN
- Recommended name:
- Serine/arginine-rich splicing factor 2
- Protein Accession:
- Q01130
- B3KWD5
- B4DN89
- H0YG49
Protein attributes for SRSF2 Gene
- Size:
- 221 amino acids
- Molecular mass:
- 25476 Da
- Quaternary structure:
-
- Interacts with BRDT (By similarity). In vitro, self-associates and binds SRSF1/SFRS1 (ASF/SF2), SNRNP70 and U2AF1 but not U2AF2. Binds SREK1/SFRS12. Interacts with CCNL1 and CCNL2. Interacts with SCAF11. Interacts with ZRSR2/U2AF1-RS2. Interacts with CCDC55 (via C-terminus).
Three dimensional structures from OCA and Proteopedia for SRSF2 Gene
Protein Expression for SRSF2 Gene
Post-translational modifications for SRSF2 Gene
- Extensively phosphorylated on serine residues in the RS domain. Phosphorylated by SRPK2 and this causes its redistribution from the nuclear speckle to nucleoplasm and controls cell fate decision in response to cisplatin treatment. KAT5/TIP60 inhibits its phosphorylation by preventing SRPK2 nuclear translocation.
- Acetylation on Lys-52 by KAT5/TIP60 promotes its proteasomal degradation. This effect is counterbalanced by HDAC6, which positively controls SRSF2 protein level by deacetylating it and preventing its proteasomal degradation.
- Modification sites at PhosphoSitePlus
- Modification sites at neXtProt
Other Protein References for SRSF2 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- Atlas Antibodies Anti-SRSF2 Antibody
- Creative Diagnostics Anti-SRSF2 monoclonal antibody, Anti-SRSF2 (full length) polyclonal antibody, and Anti-SRSF2 (aa 83-113) polyclonal antibody
- Creative Biolabs Recombinant Mouse anti-Human SRSF2 Monoclonal antibody (2H5)
- GeneTex Anti-SC35 antibody [SC-35] and Anti-SC35 antibody
-
Custom Antibody ServicesOriGene Antibodies for SRSF2
- Novus Biologicals Antibodies for SRSF2
-
Abcam antibodies for SRSF2
- Invitrogen Antibodies for SRSF2 (AFLGC-SRSF2)
- antibodies-online: Show 10 available SRSF2 Antibodies ranked by validation data
-
Biorbyt antibodies for SRSF2
-
Santa Cruz Biotechnology (SCBT) Antibodies for SRSF2
Protein Products
- Atlas Antibodies PrEST Antigen SRSF2
-
OriGene Purified Proteins for SRSF2
- Search Origene for MassSpec and Protein Over-expression Lysates for SRSF2
- Origene Custom Protein Services for SRSF2
- antibodies-online: Show 7 available SRSF2 Proteins ranked by validation data
- Compare Top SRSF2 Proteins
-
Quality Products:
-
Abcam proteins for SRSF2
Assay Products
- Aviva Systems Biology SRSF2 ELISA Kit (Human) : 96 Wells (OKEH02172) and SRSF2 ELISA Kit (Human) (OKCD08743)
- antibodies-online: Show 17 available SRSF2 Elisa Kits ranked by validation data
- Compare Top SRSF2 Elisa Kits
-
Quality Products:
No data available for DME Specific Peptides for SRSF2 Gene
Domains & Families for SRSF2 Gene
Gene Families for SRSF2 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Cancer-related genes
- Plasma proteins
- Predicted intracellular proteins
Protein Domains for SRSF2 Gene
- Blocks:
- InterPro:
- ProtoNet:
Suggested Antigen Peptide Sequences for SRSF2 Gene
- GenScript: Design optimal peptide antigens:
-
- cDNA FLJ40890 fis, clone UTERU2001024, highly similar to SPLICING FACTOR, ARGININE/SERINE-RICH 2 (B3KUY1_HUMAN)
- cDNA FLJ52570, highly similar to Splicing factor, arginine/serine-rich 2 (B4DN89_HUMAN)
- SFRS2 protein (Q6NXQ0_HUMAN)
- cDNA FLJ36307 fis, clone THYMU2004906, moderately similar to SPLICING FACTOR, ARGININE/SERINE-RICH 2 (Q8N220_HUMAN)
- cDNA FLJ35170 fis, clone PLACE6012942, highly similar to SPLICING FACTOR, ARGININE/SERINE-RICH 2 (Q8NAK9_HUMAN)
Graphical View of Domain Structure for InterPro Entry
Q01130- Family:
-
- Belongs to the splicing factor SR family.
Function for SRSF2 Gene
Molecular function for SRSF2 Gene
- UniProtKB/Swiss-Prot Function:
- Necessary for the splicing of pre-mRNA. It is required for formation of the earliest ATP-dependent splicing complex and interacts with spliceosomal components bound to both the 5'- and 3'-splice sites during spliceosome assembly. It also is required for ATP-dependent interactions of both U1 and U2 snRNPs with pre-mRNA. Interacts with other spliceosomal components, via the RS domains, to form a bridge between the 5'- and 3'-splice site binding components, U1 snRNP and U2AF. Binds to purine-rich RNA sequences, either 5'-AGSAGAGTA-3' (S=C or G) or 5'-GTTCGAGTA-3'. Can bind to beta-globin mRNA and commit it to the splicing pathway. The phosphorylated form (by SRPK2) is required for cellular apoptosis in response to cisplatin treatment.
- UniProtKB/Swiss-Prot Induction:
- Accumulates in a hypoacetylated/phosphorylated form in response to cisplatin treatment.
Phenotypes From GWAS Catalog for SRSF2 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0003676 | nucleic acid binding | IEA | -- |
| GO:0003714 | transcription corepressor activity | NAS | 15652350 |
| GO:0003723 | RNA binding | IEA,IBA | 21873635 |
| GO:0005080 | protein kinase C binding | IEA | -- |
| GO:0005515 | protein binding | IPI | 9237760 |
Phenotypes for SRSF2 Gene
- MGI mutant phenotypes for SRSF2:
- inferred from 3 alleles
- GenomeRNAi human phenotypes for SRSF2:
-
- Increased shRNA abundance (Z-score > 2)
- Decreased HIV-LTR-beta-galactosidase protein expression
- Decreased Tat-dependent HIV-LTR-beta-galactosidase protein expression
- Strongly decreased NFAT1-GFP nuclear translocation
- Negative genetic interaction between BLM-/- and BLM+/+
- Negative genetic interaction between MUS81-/- and MUS81+/+
- Negative genetic interaction between PTEN-/- and PTEN+/+
- Upregulation of Wnt/beta-catenin pathway after WNT3A stimulation
- Decreased viability in esophageal squamous lineage
- Decreased viability
- no effect
- Increased vaccinia virus (VACV) infection
- Increased gamma-H2AX phosphorylation
- Decreased melanin production
- Decreased hepcidin::fluc mRNA expression
- Decreased NF-kappaB reporter expression
- shRNA abundance <= 50%
- Increased viability
- Synthetic lethal with vaccinia virus (VACV) infection
Animal Models for SRSF2 Gene
- MGI Knock Outs for SRSF2:
-
- Srsf2 Srsf2<tm1.1Xdfu>
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
CRISPR Products
-
OriGene CRISPR knockouts for SRSF2
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for SRSF2
- genomics-online: gRNA clones - Search for available SRSF2 gRNA products
- Overview of 143 available SRSF2 gene related products
- Applied Biological Materials (abm): CRISPR Clones for SRSF2 - Select products 50% OFF >
- * SRSF2 CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * SRSF2 CRISPR applications: KO, Activation, Repression, and more - Browse All
-
Santa Cruz Biotechnology (SCBT) CRISPR for SRSF2
miRNA for SRSF2 Gene
- miRTarBase miRNAs that target SRSF2
-
- hsa-mir-34b-5p (MIRT004404)
- hsa-mir-34c-5p (MIRT004405)
- hsa-mir-183-5p (MIRT004741)
- hsa-mir-130b-3p (MIRT020317)
- hsa-mir-155-5p (MIRT020895)
- hsa-mir-93-5p (MIRT028143)
- hsa-mir-186-5p (MIRT045026)
- hsa-let-7e-5p (MIRT051575)
- hsa-let-7a-5p (MIRT052509)
- hsa-mir-4731-3p (MIRT078910)
- hsa-mir-4801 (MIRT078912)
- hsa-mir-607 (MIRT289184)
- hsa-mir-3679-3p (MIRT345866)
- hsa-mir-4446-5p (MIRT345867)
- hsa-mir-4666a-5p (MIRT345868)
- hsa-mir-4724-3p (MIRT345874)
- hsa-mir-4671-3p (MIRT345894)
- hsa-mir-106b-5p (MIRT439653)
- hsa-mir-20a-5p (MIRT439654)
- hsa-mir-30e-3p (MIRT505473)
- hsa-mir-30d-3p (MIRT505474)
- hsa-mir-30a-3p (MIRT505475)
- hsa-mir-29b-2-5p (MIRT505476)
- hsa-mir-5589-3p (MIRT505477)
- hsa-mir-885-5p (MIRT505478)
- hsa-mir-4328 (MIRT505479)
- hsa-mir-4692 (MIRT505480)
- hsa-mir-4514 (MIRT505481)
- hsa-mir-6715b-5p (MIRT505482)
- hsa-mir-4269 (MIRT505483)
- hsa-mir-4742-5p (MIRT505484)
- hsa-mir-4717-3p (MIRT505485)
- hsa-mir-519c-3p (MIRT505486)
- hsa-mir-519b-3p (MIRT505487)
- hsa-mir-519a-3p (MIRT505488)
- hsa-mir-4796-3p (MIRT505489)
- hsa-mir-526b-3p (MIRT505490)
- hsa-mir-519d-3p (MIRT505491)
- hsa-mir-20b-5p (MIRT505492)
- hsa-mir-17-5p (MIRT505493)
- hsa-mir-106a-5p (MIRT505494)
- hsa-mir-548ah-5p (MIRT505495)
- hsa-mir-3609 (MIRT505496)
- hsa-mir-6083 (MIRT561492)
- hsa-mir-675-3p (MIRT561493)
- hsa-mir-4745-3p (MIRT561494)
- hsa-mir-1538 (MIRT561495)
- hsa-mir-4708-3p (MIRT561496)
- hsa-mir-1304-3p (MIRT561497)
- hsa-mir-1208 (MIRT561498)
- hsa-mir-6760-3p (MIRT561499)
- hsa-mir-3922-5p (MIRT561500)
- hsa-mir-4747-3p (MIRT561501)
- hsa-mir-134-5p (MIRT561502)
- hsa-mir-3118 (MIRT561503)
- hsa-mir-1468-5p (MIRT561504)
- hsa-mir-2355-5p (MIRT561505)
- hsa-mir-3691-3p (MIRT561506)
- hsa-mir-6793-3p (MIRT561507)
- hsa-mir-6757-3p (MIRT561508)
- hsa-mir-548v (MIRT571610)
- hsa-mir-187-5p (MIRT571611)
- hsa-mir-6720-3p (MIRT571612)
- hsa-mir-668-5p (MIRT571613)
- hsa-mir-6080 (MIRT571614)
- hsa-mir-888-5p (MIRT571615)
- hsa-mir-221-3p (MIRT571616)
- hsa-mir-222-3p (MIRT571617)
- hsa-mir-301a-3p (MIRT571618)
- hsa-mir-4295 (MIRT571619)
- hsa-mir-3666 (MIRT571620)
- hsa-mir-454-3p (MIRT571621)
- hsa-mir-301b-3p (MIRT571622)
- hsa-mir-130a-3p (MIRT571623)
- hsa-mir-5096 (MIRT644619)
- hsa-mir-599 (MIRT644620)
- hsa-mir-3161 (MIRT644621)
- hsa-mir-627-3p (MIRT644622)
- hsa-mir-6765-3p (MIRT644623)
- hsa-mir-3622b-3p (MIRT644624)
- hsa-mir-3622a-3p (MIRT644625)
- hsa-mir-3613-3p (MIRT644626)
- hsa-mir-501-5p (MIRT644627)
- hsa-mir-500a-5p (MIRT644628)
- hsa-mir-1264 (MIRT644629)
- hsa-mir-551b-5p (MIRT644630)
- hsa-mir-548c-3p (MIRT644631)
- hsa-mir-2909 (MIRT698850)
- hsa-mir-4278 (MIRT698851)
- hsa-mir-6789-5p (MIRT698852)
- hsa-mir-6824-5p (MIRT698853)
- hsa-mir-376a-2-5p (MIRT698854)
- hsa-mir-3935 (MIRT698855)
- hsa-mir-4772-5p (MIRT698856)
- hsa-mir-383-5p (MIRT698857)
- hsa-mir-153-5p (MIRT698858)
- hsa-mir-10b-3p (MIRT698859)
- hsa-mir-3668 (MIRT698860)
- hsa-mir-6512-5p (MIRT698861)
- hsa-mir-148a-5p (MIRT698862)
- hsa-mir-485-3p (MIRT698863)
- hsa-mir-539-3p (MIRT698864)
- hsa-mir-193a-3p (MIRT733934)
- hsa-mir-3130-3p (MIRT740079)
- hsa-mir-4261 (MIRT743479)
- hsa-mir-4496 (MIRT745341)
- hsa-mir-4793-3p (MIRT748941)
- hsa-mir-570-3p (MIRT751378)
- hsa-mir-6746-5p (MIRT754497)
- hsa-mir-6771-5p (MIRT755314)
- hsa-mir-6878-5p (MIRT758237)
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for SRSF2
- Browse OriGene Inhibitory RNA Products For SRSF2
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for SRSF2
- genomics-online: shRNA clones - Search for available SRSF2 shRNA products
- Overview of 143 available SRSF2 gene related products
Clone Products
- Sino Biological Human cDNA Clone for SRSF2
- Addgene plasmids for SRSF2
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for SRSF2
- genomics-online: cdna clones - Search for available SRSF2 CDNA products
- Overview of 143 available SRSF2 gene related products
- orf clones - Search for available SRSF2 ORF products
- Overview of 143 available SRSF2 gene related products
- Applied Biological Materials (abm): Clones for SRSF2 - Select products 50% OFF >
- * SRSF2 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * SRSF2 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for SRSF2 Gene
Localization for SRSF2 Gene
Subcellular locations from UniProtKB/Swiss-Prot for SRSF2 Gene
- Nucleus. Nucleus, nucleoplasm. Nucleus speckle. Note=Phosphorylation by SRPK2 provokes its redistribution from the nuclear specke to nucleoplasm.
| Compartment | Confidence |
|---|---|
| nucleus | 5 |
| cytosol | 4 |
| cytoskeleton | 1 |
- Nucleus (3)
- Cytosol (2)
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005634 | nucleus | IDA | 15652350 |
| GO:0005654 | nucleoplasm | TAS | -- |
| GO:0005681 | spliceosomal complex | IEA | -- |
| GO:0005737 | cytoplasm | IBA | 21873635 |
| GO:0005829 | cytosol | IDA | -- |
Pathways & Interactions for SRSF2 Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | mRNA Splicing - Major Pathway |
.79
|
.50
.41
|
| 2 | Cleavage of Growing Transcript in the Termination Region | ||
| 3 | Transport of Mature Transcript to Cytoplasm | ||
| 4 | Herpes simplex virus 1 infection | ||
| 5 | Gene Expression |
.48
|
|
Pathways by source for SRSF2 Gene
1 BioSystems pathway for SRSF2 Gene
11 Reactome pathways for SRSF2 Gene
2 KEGG pathways for SRSF2 Gene
Interacting Proteins for SRSF2 Gene
Selected Interacting proteins:
Q01130-SRSF2_HUMAN
ENSP00000376276
for SRSF2 Gene via
UniProtKB
MINT
STRING
IID
GPS-Prot Interaction Network for SRSF2
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000278 | mitotic cell cycle | IEA | -- |
| GO:0000381 | regulation of alternative mRNA splicing, via spliceosome | IBA,IEA | 21873635 |
| GO:0000398 | mRNA splicing, via spliceosome | TAS | -- |
| GO:0006397 | mRNA processing | TAS | 8530103 |
| GO:0006405 | RNA export from nucleus | TAS | -- |
Transcripts for SRSF2 Gene
mRNA/cDNA for SRSF2 Gene
- (2) REFSEQ mRNAs :
- (22) Additional mRNA sequences :
- (1026) Selected AceView cDNA sequences:
- (11) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
-
- ENST00000358156 572 bps (ENST00000358156.6)
- ENST00000359995 1927 bps (ENST00000359995.9)
- ENST00000392485 2885 bps (ENST00000392485.2)
- ENST00000452355 1357 bps (ENST00000452355.7)
- ENST00000508921 1390 bps (ENST00000508921.7)
CRISPR Products
-
OriGene CRISPR knockouts for SRSF2
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for SRSF2
- genomics-online: gRNA clones - Search for available SRSF2 gRNA products
- Overview of 143 available SRSF2 gene related products
- Applied Biological Materials (abm): CRISPR Clones for SRSF2 - Select products 50% OFF >
- * SRSF2 CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * SRSF2 CRISPR applications: KO, Activation, Repression, and more - Browse All
-
Santa Cruz Biotechnology (SCBT) CRISPR for SRSF2
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for SRSF2
- Browse OriGene Inhibitory RNA Products For SRSF2
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for SRSF2
- genomics-online: shRNA clones - Search for available SRSF2 shRNA products
- Overview of 143 available SRSF2 gene related products
Clone Products
- Sino Biological Human cDNA Clone for SRSF2
- Addgene plasmids for SRSF2
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for SRSF2
- genomics-online: cdna clones - Search for available SRSF2 CDNA products
- Overview of 143 available SRSF2 gene related products
- orf clones - Search for available SRSF2 ORF products
- Overview of 143 available SRSF2 gene related products
- Applied Biological Materials (abm): Clones for SRSF2 - Select products 50% OFF >
- * SRSF2 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * SRSF2 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
| ExUns: | 1a | · | 1b | ^ | 2a | · | 2b | ^ | 3a | · | 3b | · | 3c | ^ | 4 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | |||||||||||||||
| SP2: | - | - | |||||||||||||
| SP3: | - | - |
Expression for SRSF2 Gene
This gene is overexpressed in NK cells (8.1).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for SRSF2 Gene
NURSA nuclear receptor signaling pathways regulating expression of SRSF2 Gene:
SRSF2SOURCE GeneReport for Unigene cluster for SRSF2 Gene:
Hs.584801Evidence on tissue expression from TISSUES for SRSF2 Gene
- Nervous system(5)
- Lung(4.9)
- Liver(4.7)
- Bone marrow(4.6)
- Intestine(4.6)
- Kidney(4.3)
- Spleen(4.3)
- Blood(3.9)
- Skin(3.9)
- Stomach(3.8)
- Heart(3.7)
- Eye(2.9)
- Pancreas(2.5)
- Muscle(2.3)
- Lymph node(2.1)
Primer Products
-
OriGene qPCR primer pairs for SRSF2
-
OriGene qPCR primer pairs and template standards for SRSF2
- genomics-online: primer clones - Search for available SRSF2 Primer products
- Overview of 143 available SRSF2 gene related products
Gene Expression Assay Products
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for SRSF2 Gene
Orthologs for SRSF2 Gene
This gene was present in the common ancestor of animals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| platypus (Ornithorhynchus anatinus) |
Mammalia | -- 33 |
|
OneToMany | |
| dog (Canis familiaris) |
Mammalia | -- 33 |
|
OneToMany | |
| SRSF2 32 |
|
||||
| chimpanzee (Pan troglodytes) |
Mammalia | SRSF2 33 32 |
|
OneToOne | |
| cow (Bos Taurus) |
Mammalia | SRSF2 33 32 |
|
OneToMany | |
| rat (Rattus norvegicus) |
Mammalia | Srsf2 32 |
|
||
| mouse (Mus musculus) |
Mammalia | Srsf2 17 33 32 |
|
||
| oppossum (Monodelphis domestica) |
Mammalia | -- 33 |
|
OneToMany | |
| chicken (Gallus gallus) |
Aves | SRSF2 33 32 |
|
OneToMany | |
| lizard (Anolis carolinensis) |
Reptilia | -- 33 |
|
OneToMany | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | MGC75633 32 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | srsf2a 33 |
|
ManyToMany | |
| srsf2b 33 |
|
ManyToMany | |||
| Dr.8481 32 |
|
||||
| rainbow trout (Oncorhynchus mykiss) |
Actinopterygii | Omy.3833 32 |
|
||
| fruit fly (Drosophila melanogaster) |
Insecta | SC35 33 |
|
OneToMany | |
| worm (Caenorhabditis elegans) |
Secernentea | rsp-4 33 |
|
OneToMany | |
| sea squirt (Ciona savignyi) |
Ascidiacea | CSA.11125 33 |
|
OneToMany | |
| Cin.3433 32 |
|
||||
| sea squirt (Ciona intestinalis) |
Ascidiacea | Cin.3433 32 |
|
- Species where no ortholog for SRSF2 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Evolution for SRSF2 Gene
- ENSEMBL:
- Gene Tree for SRSF2 (if available)
- TreeFam:
- Gene Tree for SRSF2 (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for SRSF2: view image
Paralogs for SRSF2 Gene
(18) SIMAP similar genes for SRSF2 Gene using alignment to 3 proteins:
- SRSF2_HUMAN
- J3KP15_HUMAN
- J3QL05_HUMAN
Pseudogenes.org Pseudogenes for SRSF2 Gene
Variants for SRSF2 Gene
| SNP ID | Clin | Chr 17 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs1443221868 | uncertain-significance, Inborn genetic diseases | 76,733,617(-) | A/ | downstream_transcript_variant | |
| rs757197161 | likely-pathogenic, not provided | 76,733,649(-) | AAATGCTGGT/AAATGCTGGTAAATGCTGGT | downstream_transcript_variant | |
| rs147321492 | conflicting-interpretations-of-pathogenicity, not provided | 76,733,682(-) | T/C | downstream_transcript_variant | |
| rs1064796272 | uncertain-significance, not provided | 76,736,272(-) | GGACCTGGACC/GGACC | coding_sequence_variant, inframe_deletion, non_coding_transcript_variant | |
| rs1000409899 | -- | 76,736,096(-) | C/G | 3_prime_UTR_variant, intron_variant, non_coding_transcript_variant |
Residual Variation Intolerance Score:
26.4% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for SRSF2 Gene
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SRSF2 Gene
Disorders for SRSF2 Gene
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| systemic mastocytosis with an associated clonal hematologic non-mast cell lineage disease |
|
|
| chronic neutrophilic leukemia |
|
|
| bestrophinopathy, autosomal recessive |
|
|
| holt-oram syndrome |
|
|
| systemic mastocytosis |
|
|
Search SRSF2 in MalaCards
View complete list of genes associated with diseases
Additional Disease Information for SRSF2
No data available for UniProtKB/Swiss-Prot and Genatlas for SRSF2 Gene
Publications for SRSF2 Gene
- Chromosomal localization of mouse and human genes encoding the splicing factors ASF/SF2 (SFRS1) and SC-35 (SFRS2). (PMID: 8530103) Bermingham JR … Rosenfeld MG (Genomics 1995) 2 3 23 56
- Specific interactions between proteins implicated in splice site selection and regulated alternative splicing. (PMID: 8261509) Wu JY … Maniatis T (Cell 1993) 3 4 23 56
- Isolation of a complementary DNA that encodes the mammalian splicing factor SC35. (PMID: 1373910) Fu XD … Maniatis T (Science (New York, N.Y.) 1992) 3 4 23 56
- Acetylation and phosphorylation of SRSF2 control cell fate decision in response to cisplatin. (PMID: 21157427) Edmond V … Eymin B (The EMBO journal 2011) 3 4 56
- NSrp70 is a novel nuclear speckle-related protein that modulates alternative pre-mRNA splicing in vivo. (PMID: 21296756) Kim YD … Jun CD (Nucleic acids research 2011) 3 4 56
ExternalLinks
Products for SRSF2 Gene
- Custom Antibody ServicesOriGene Antibodies for SRSF2
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for SRSF2
- Search Origene for MassSpec and Protein Over-expression Lysates for SRSF2
- Origene Custom Protein Services for SRSF2
- Origene sirna, shrna, and RNAi products in human, mouse, rat for SRSF2
- Browse OriGene Inhibitory RNA Products For SRSF2
- OriGene qPCR primer pairs for SRSF2
- OriGene qPCR primer pairs and template standards for SRSF2
- OriGene CRISPR knockouts for SRSF2
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For SRSF2
- Sino Biological Human cDNA Clone for SRSF2
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse cDNA Clones
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Novus Biologicals Antibodies for SRSF2
- Novus Biologicals proteins and lysates for SRSF2
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for SRSF2
- Abcam proteins for SRSF2
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Invitrogen Antibodies for SRSF2 (AFLGC-SRSF2)
- Addgene plasmids for SRSF2
- antibodies-online: Show 10 available SRSF2 Antibodies ranked by validation data
- antibodies-online: Show 17 available SRSF2 Elisa Kits ranked by validation data
- Compare Top SRSF2 Elisa Kits
- Quality Products:
- antibodies-online: Show 7 available SRSF2 Proteins ranked by validation data
- Compare Top SRSF2 Proteins
- Quality Products:
- Santa Cruz Biotechnology (SCBT) Antibodies for SRSF2
- Search Santa Cruz Biotechnology (SCBT) for SRSF2 siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for SRSF2
- genomics-online: cdna clones - Search for available SRSF2 CDNA products
- Overview of 143 available SRSF2 gene related products
- orf clones - Search for available SRSF2 ORF products
- Overview of 143 available SRSF2 gene related products