Free for academic non-profit institutions. Other users need a Commercial license

SPEG Gene(Protein Coding)

SPEG Complex Locus

GCID:
GC02P219434
GIFtS:
47
Genes Participants
UDN Logo

Aliases for SPEG Gene

Aliases for SPEG Gene

  • SPEG Complex Locus 2 3 5
  • Striated Muscle Preferentially Expressed Protein Kinase 2 3
  • Aortic Preferentially Expressed Protein 1 3 4
  • Aortic Preferentially Expressed Gene 1 2 3
  • APEG-1 3 4
  • APEG1 3 4
  • Nuclear Protein, Marker For Differentiated Aortic Smooth Muscle And Down-Regulated With Vascular Injury 3
  • EC 2.7.11.1 4
  • SPEGalpha 3
  • SPEGbeta 3
  • KIAA1297 4
  • BPEG 3
  • CNM5 3

External Ids for SPEG Gene

Previous HGNC Symbols for SPEG Gene

  • APEG1

Previous GeneCards Identifiers for SPEG Gene

  • GC02P220007
  • GC02P220299
  • GC02P212152

Summaries for SPEG Gene

Entrez Gene Summary for SPEG Gene

  • This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Along with the desmin gene, expression of this gene may be controlled by the desmin locus control region. Mutations in this gene are associated with centronuclear myopathy 5. [provided by RefSeq, Jun 2016]

GeneCards Summary for SPEG Gene

SPEG (SPEG Complex Locus) is a Protein Coding gene. Diseases associated with SPEG include Myopathy, Centronuclear, 5 and Myopathy, Centronuclear, 2. Gene Ontology (GO) annotations related to this gene include transferase activity, transferring phosphorus-containing groups and protein tyrosine kinase activity. An important paralog of this gene is MYLK.

UniProtKB/Swiss-Prot for SPEG Gene

  • Isoform 3 may have a role in regulating the growth and differentiation of arterial smooth muscle cells.

Gene Wiki entry for SPEG Gene

Additional gene information for SPEG Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SPEG Gene

Genomics for SPEG Gene

Products:

  1. Regulatory Element

GeneHancer (GH) Regulatory Elements for SPEG Gene

Promoters and enhancers for SPEG Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH02J219457 Promoter/Enhancer 1.7 EPDnew Ensembl ENCODE dbSUPER 663.6 +25.7 25655 4.5 ARID4B SIN3A ZNF2 RAD21 GLIS2 ZNF143 THAP11 NFKBIZ EGR2 REST SPEG GMPPA ASIC4 ENSG00000227432 DES OBSL1 PTPRN LOC100996693
GH02J219433 Enhancer 1.1 Ensembl ENCODE dbSUPER 661.3 +0.7 739 3.1 HDGF CTCF FOXA2 RB1 E4F1 RAD21 TCF12 CC2D1A ZFHX2 POLR2A SPEG ENSG00000269068 DNPEP ASIC4 LOC100996693
GH02J219397 Enhancer 1.3 Ensembl ENCODE dbSUPER 11.2 -35.2 -35164 3.7 PKNOX1 ATF1 FOXA2 FEZF1 YY1 ATF7 FOS RXRA REST ZNF592 DNPEP OBSL1 ENSG00000269068 ENSG00000268896 ASIC4 ENSG00000227432 ENSG00000268603 SPEG GMPPA TMEM198
GH02J219401 Enhancer 1.1 Ensembl ENCODE dbSUPER 11.2 -31.6 -31572 1.6 CTCF MXI1 ARID4B RAD21 TEAD3 ARID2 ZNF143 SMC3 EZH2 ZNF654 ASIC4 ENSG00000227432 SPEG GMPPA DNPEP LOC105373884 DES
GH02J219463 Enhancer 0.7 dbSUPER 13.6 +34.9 34872 10.3 BCOR MEIS2 SUZ12 ZSCAN4 BACH1 ZMYM3 ZIC2 ZFHX2 GATA3 ZNF316 ASIC4 GMPPA SPEG DES ENSG00000227432 OBSL1 ENSG00000268603 LOC100996693
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SPEG on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SPEG gene promoter:
  • AP-1
  • TBP
  • MyoD
  • p53

Genomic Locations for SPEG Gene

Genomic Locations for SPEG Gene
chr2:219,434,192-219,498,287
(GRCh38/hg38)
Size:
64,096 bases
Orientation:
Plus strand
chr2:220,299,568-220,363,009
(GRCh37/hg19)
Size:
63,442 bases
Orientation:
Plus strand

Genomic View for SPEG Gene

Genes around SPEG on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SPEG Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SPEG Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for SPEG Gene

Proteins for SPEG Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for SPEG Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q15772-SPEG_HUMAN
    Recommended name:
    Striated muscle preferentially expressed protein kinase
    Protein Accession:
    Q15772
    Secondary Accessions:
    • A8K0G6
    • A8MRU0
    • Q27J74
    • Q695L1
    • Q6FGA6
    • Q6ZQW1
    • Q6ZTL8
    • Q9P2P9

    Protein attributes for SPEG Gene

    Size:
    3267 amino acids
    Molecular mass:
    354289 Da
    Quaternary structure:
    • Interacts with MTM1. Isoform 3 is found as a monomer or homodimer.
    Miscellaneous:
    • Expression is under the tight control of the locus control region (LCRs).
    SequenceCaution:
    • Sequence=AAY15052.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305}; Sequence=ABD61734.1; Type=Frameshift; Positions=31, 35; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for SPEG Gene

    Alternative splice isoforms for SPEG Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for SPEG Gene

Protein Expression for SPEG Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for SPEG Gene

Other Protein References for SPEG Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for SPEG Gene

Domains & Families for SPEG Gene

Gene Families for SPEG Gene

HGNC:
IUPHAR :
Human Protein Atlas (HPA):
  • Disease related genes
  • Enzymes
  • Potential drug targets
  • Predicted intracellular proteins

Protein Domains for SPEG Gene

Blocks:
InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for SPEG Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q15772

UniProtKB/Swiss-Prot:

SPEG_HUMAN :
  • Belongs to the protein kinase superfamily. CAMK Ser/Thr protein kinase family.
Family:
  • Belongs to the protein kinase superfamily. CAMK Ser/Thr protein kinase family.
genes like me logo Genes that share domains with SPEG: view

Function for SPEG Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for SPEG Gene

UniProtKB/Swiss-Prot Function:
Isoform 3 may have a role in regulating the growth and differentiation of arterial smooth muscle cells.
UniProtKB/Swiss-Prot CatalyticActivity:
ATP + a protein = ADP + a phosphoprotein.
UniProtKB/Swiss-Prot Induction:
Isoform 3 is quickly down-regulated in response to vascular injury, when ASMC cells change from a quiescent to a proliferative phenotype.

Enzyme Numbers (IUBMB) for SPEG Gene

Phenotypes From GWAS Catalog for SPEG Gene

Gene Ontology (GO) - Molecular Function for SPEG Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004672 protein kinase activity IEA --
GO:0004674 protein serine/threonine kinase activity IEA --
GO:0005515 protein binding IEA,IPI 25416956
GO:0005524 ATP binding IEA --
GO:0016301 kinase activity IEA --
genes like me logo Genes that share ontologies with SPEG: view
genes like me logo Genes that share phenotypes with SPEG: view

Human Phenotype Ontology for SPEG Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for SPEG Gene

MGI Knock Outs for SPEG:
  • Speg Speg<tm1Mkap>
  • Speg Speg<tm1b(KOMP)Wtsi>

Animal Model Products

  • Taconic Biosciences Mouse Models for SPEG

Clone Products

No data available for miRNA , Transcription Factor Targets and HOMER Transcription for SPEG Gene

Localization for SPEG Gene

Subcellular locations from UniProtKB/Swiss-Prot for SPEG Gene

Isoform 3: Nucleus.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SPEG gene
Compartment Confidence
nucleus 5
plasma membrane 3
cytosol 3
endosome 2
extracellular 1
lysosome 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Vesicles (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for SPEG Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA,TAS --
genes like me logo Genes that share ontologies with SPEG: view

Pathways & Interactions for SPEG Gene

SuperPathways for SPEG Gene

PathCards logo More details on SuperPathways for SPEG
No Data Available

Gene Ontology (GO) - Biological Process for SPEG Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006468 protein phosphorylation IEA --
GO:0007517 muscle organ development TAS 8663449
GO:0008285 negative regulation of cell proliferation TAS 8663449
GO:0016310 phosphorylation IEA --
GO:0030154 cell differentiation IEA --
genes like me logo Genes that share ontologies with SPEG: view

No data available for Pathways by source and SIGNOR curated interactions for SPEG Gene

Drugs & Compounds for SPEG Gene

Products:

  1. Drug
No Compound Related Data Available

Transcripts for SPEG Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for SPEG Gene

(18) REFSEQ mRNAs :
(12) Additional mRNA sequences :
(87) Selected AceView cDNA sequences:
(25) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for SPEG Gene

SPEG complex locus:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for SPEG Gene

No ASD Table

Relevant External Links for SPEG Gene

GeneLoc Exon Structure for
SPEG
ECgene alternative splicing isoforms for
SPEG

Expression for SPEG Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SPEG Gene

mRNA expression in normal human tissues for SPEG Gene
mRNA expression by GTEx for SPEG GenemRNA expression by BioGPS for SPEG Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for SPEG Gene

This gene is overexpressed in Artery - Tibial (x4.9), Muscle - Skeletal (x4.8), Artery - Aorta (x4.8), and Colon - Sigmoid (x4.0).

Protein differential expression in normal tissues from HIPED for SPEG Gene

This gene is overexpressed in Ovary (28.0) and Heart (6.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for SPEG Gene



NURSA nuclear receptor signaling pathways regulating expression of SPEG Gene:

SPEG

SOURCE GeneReport for Unigene cluster for SPEG Gene:

Hs.21639

mRNA Expression by UniProt/SwissProt for SPEG Gene:

Q15772-SPEG_HUMAN
Tissue specificity: Isoform 1 is preferentially expressed in striated muscle. Non-kinase form such as isoform 3 is predominantly expressed in the aorta. Isoform 3 appears to be expressed only in highly differentiated ASMC in normal vessel walls and down-regulated in dedifferentiated ASMC in vivo. In response to vascular injuries ASMC dedifferentiate and change from a quiescent and contractile phenotype to a proliferative and synthetic phenotype. This proliferation of vascular smooth muscle cells is one of the most prominent features of atherosclerosis.

Evidence on tissue expression from TISSUES for SPEG Gene

  • Nervous system(4.7)
  • Muscle(3.3)

Phenotype-based relationships between genes and organs from Gene ORGANizer for SPEG Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • integumentary
  • nervous
  • respiratory
  • skeletal muscle
  • skeleton
Regions:
Head and neck:
  • brain
  • chin
  • cranial nerve
  • ear
  • eye
  • eyelid
  • face
  • head
  • jaw
  • larynx
  • lip
  • mandible
  • maxilla
  • mouth
  • neck
  • skull
  • vocal cord
Thorax:
  • heart
  • heart valve
  • lung
  • rib
  • rib cage
Pelvis:
  • pelvis
Limb:
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • finger
  • foot
  • forearm
  • hand
  • hip
  • knee
  • lower limb
  • shin
  • shoulder
  • thigh
  • toe
  • upper limb
  • wrist
General:
  • peripheral nerve
  • peripheral nervous system
  • skin
  • spinal column
  • spinal cord
  • vertebrae
genes like me logo Genes that share expression patterns with SPEG: view

No data available for Protein tissue co-expression partners for SPEG Gene

Orthologs for SPEG Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for SPEG Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia SPEG 34 33
  • 97.91 (n)
 OneToOne
cow
(Bos Taurus)
 Mammalia SPEG 34 33
  • 89.89 (n)
 OneToOne
dog
(Canis familiaris)
 Mammalia SPEG 34 33
  • 88.99 (n)
 OneToOne
mouse
(Mus musculus)
 Mammalia Speg 16 34 33
  • 87.24 (n)
rat
(Rattus norvegicus)
 Mammalia Speg 33
  • 87.22 (n)
oppossum
(Monodelphis domestica)
 Mammalia SPEG 34
  • 81 (a)
 OneToOne
platypus
(Ornithorhynchus anatinus)
 Mammalia -- 34
  • 35 (a)
 ManyToMany
chicken
(Gallus gallus)
 Aves SPEG 34 33
  • 71.23 (n)
 OneToOne
lizard
(Anolis carolinensis)
 Reptilia SPEG 34
  • 53 (a)
 OneToOne
tropical clawed frog
(Silurana tropicalis)
 Amphibia speg 33
  • 57.95 (n)
zebrafish
(Danio rerio)
 Actinopterygii si:ch211-195m20.1 33
  • 56.5 (n)
SPEG (1 of 2) 34
  • 45 (a)
 OneToMany
speg 34
  • 41 (a)
 OneToMany
worm
(Caenorhabditis elegans)
 Secernentea unc-22 34
  • 4 (a)
 OneToMany
baker's yeast
(Saccharomyces cerevisiae)
 Saccharomycetes MEK1 34
  • 23 (a)
 OneToMany
Species where no ortholog for SPEG was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for SPEG Gene

ENSEMBL:
Gene Tree for SPEG (if available)
TreeFam:
Gene Tree for SPEG (if available)
Aminode:
Evolutionary constrained regions (ECRs) for SPEG: view image

Paralogs for SPEG Gene

Paralogs for SPEG Gene

(20) SIMAP similar genes for SPEG Gene using alignment to 10 proteins:

  • SPEG_HUMAN
  • B9A038_HUMAN
  • B9ZVR7_HUMAN
  • C9J8D8_HUMAN
  • C9JWU5_HUMAN
  • F8WCA7_HUMAN
  • G5E9J7_HUMAN
  • H0Y3W0_HUMAN
  • H7BZM6_HUMAN
  • H7C3Y5_HUMAN
genes like me logo Genes that share paralogs with SPEG: view

Variants for SPEG Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Sequence variations from dbSNP and Humsavar for SPEG Gene

SNP ID Clin Chr 02 pos Variation AA Info Type
rs566841339 A gastric adenocarcinoma sample 219,489,128(+) G/A coding_sequence_variant, genic_downstream_transcript_variant, missense_variant
rs587777672 pathogenic, Myopathy, centronuclear, 5 219,484,160(+) C/A/G/T coding_sequence_variant, genic_downstream_transcript_variant, missense_variant, stop_gained
rs587777673 pathogenic, Myopathy, centronuclear, 5 219,473,732(+) C/G/T 5_prime_UTR_variant, coding_sequence_variant, genic_downstream_transcript_variant, missense_variant, non_coding_transcript_variant, stop_gained
rs587777674 pathogenic, Myopathy, centronuclear, 5 219,469,371(+) TGACACAGTGTACGTGTCTGGGAAGTTCCCCGGGAGTG/TG coding_sequence_variant, genic_downstream_transcript_variant, genic_upstream_transcript_variant, intron_variant, non_coding_transcript_variant, splice_donor_variant
rs587777675 pathogenic, Myopathy, centronuclear, 5 219,467,207(+) CC/A coding_sequence_variant, downstream_transcript_variant, frameshift, genic_downstream_transcript_variant, genic_upstream_transcript_variant, intron_variant, non_coding_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for SPEG Gene

Variant ID Type Subtype PubMed ID
nsv834544 CNV loss 17160897
nsv584502 CNV gain 21841781
nsv520958 CNV loss 19592680
nsv508886 CNV insertion 20534489
nsv470518 CNV loss 18288195
nsv213401 CNV deletion 16902084
nsv1150236 CNV deletion 26484159
nsv1136473 CNV deletion 24896259
nsv1112778 CNV deletion 24896259
nsv1071648 CNV deletion 25765185
esv3026745 CNV deletion 24192839
esv2721486 CNV deletion 23290073
esv2721485 CNV deletion 23290073

Variation tolerance for SPEG Gene

Residual Variation Intolerance Score: 26.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 20.31; 99.07% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for SPEG Gene

Human Gene Mutation Database (HGMD)
SPEG
SNPedia medical, phenotypic, and genealogical associations of SNPs for
SPEG

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SPEG Gene

Disorders for SPEG Gene

MalaCards: The human disease database

(8) MalaCards diseases for SPEG Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
myopathy, centronuclear, 5
  • cnm5
myopathy, centronuclear, 2
  • cnm2
centronuclear myopathy
  • myotubular myopathy
mastoiditis
scarlet fever
  • scarlatina
- elite association - COSMIC cancer census association via MalaCards
Search SPEG in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

SPEG_HUMAN
  • Myopathy, centronuclear, 5 (CNM5) [MIM:615959]: A form of centronuclear myopathy, a congenital muscle disorder characterized by progressive muscular weakness and wasting involving mainly limb girdle, trunk, and neck muscles. It may also affect distal muscles. Weakness may be present during childhood or adolescence or may not become evident until the third decade of life. Ptosis is a frequent clinical feature. The most prominent histopathologic features include high frequency of centrally located nuclei in muscle fibers not secondary to regeneration, radial arrangement of sarcoplasmic strands around the central nuclei, and predominance and hypotrophy of type 1 fibers. CNM5 features include severe neonatal hypotonia with respiratory insufficiency, difficulty feeding, and delayed motor development. Some patients die in infancy, and some develop dilated cardiomyopathy. {ECO:0000269 PubMed:25087613}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for SPEG

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with SPEG: view

No data available for Genatlas for SPEG Gene

Publications for SPEG Gene

  1. APEG-1, a novel gene preferentially expressed in aortic smooth muscle cells, is down-regulated by vascular injury. (PMID: 8663449) Hsieh CM … Lee ME (The Journal of biological chemistry 1996) 2 3 4 22 58
  2. The human desmin locus: gene organization and LCR-mediated transcriptional control. (PMID: 16545539) Tam JL … Antoniou M (Genomics 2006) 3 4 22 58
  3. Striated muscle preferentially expressed genes alpha and beta are two serine/threonine protein kinases derived from the same gene as the aortic preferentially expressed gene-1. (PMID: 10973969) Hsieh CM … Lee ME (The Journal of biological chemistry 2000) 2 3 22 58
  4. SPEG (Striated Muscle Preferentially Expressed Protein Kinase) Is Essential for Cardiac Function by Regulating Junctional Membrane Complex Activity. (PMID: 27729468) Quick AP … Wehrens XH (Circulation research 2017) 2 3 58
  5. SPEG interacts with myotubularin, and its deficiency causes centronuclear myopathy with dilated cardiomyopathy. (PMID: 25087613) Agrawal PB … Beggs AH (American journal of human genetics 2014) 3 4 58

Products for SPEG Gene

Sources for SPEG Gene

Content
Loading form....