Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SOX11 Gene

Aliases for SOX11 Gene

  • SRY-Box 11 2 3 5
  • SRY-Related HMG-Box Gene 11 2 3
  • SRY (Sex Determining Region Y)-Box 11 2
  • SRY (Sex-Determining Region Y)-Box 11 3
  • Transcription Factor SOX-11 3
  • SRY Box 11 2
  • MRD27 3

External Ids for SOX11 Gene

Previous GeneCards Identifiers for SOX11 Gene

  • GC02P005617
  • GC02P005884
  • GC02P005854
  • GC02P005783
  • GC02P005834
  • GC02P005842
  • GC02P005694
  • GC02P005697
  • GC02P005698
  • GC02P005699
  • GC02P005700
  • GC02P005701
  • GC02P005702

Summaries for SOX11 Gene

Entrez Gene Summary for SOX11 Gene

  • This intronless gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The protein may function in the developing nervous system and play a role in tumorigenesis. [provided by RefSeq, Jul 2008]

GeneCards Summary for SOX11 Gene

SOX11 (SRY-Box 11) is a Protein Coding gene. Diseases associated with SOX11 include Mental Retardation, Autosomal Dominant 27 and Coffin-Siris Syndrome 1. Among its related pathways are ERK Signaling and Preimplantation Embryo. Gene Ontology (GO) annotations related to this gene include DNA binding transcription factor activity and RNA polymerase II core promoter sequence-specific DNA binding. An important paralog of this gene is SOX4.

UniProtKB/Swiss-Prot for SOX11 Gene

  • Transcriptional factor involved in the embryonic neurogenesis. May also have a role in tissue modeling during development.

Gene Wiki entry for SOX11 Gene

Additional gene information for SOX11 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SOX11 Gene

Genomics for SOX11 Gene

GeneHancer (GH) Regulatory Elements for SOX11 Gene

Promoters and enhancers for SOX11 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH02I005689 Promoter/Enhancer 2.2 UCNEbase EPDnew Ensembl ENCODE dbSUPER 550.8 +1.4 1382 8.7 CTCF MXI1 USF1 MAX SIN3A SP1 POLR2A CREB1 RCOR1 ZFX GC02P005692 GC02P005693 SOX11 ENSG00000230090 ENSG00000242540 LINC01248 GC02M005657
GH02I006073 Enhancer 0.7 Ensembl ENCODE 26.1 +381.3 381279 1.5 MXI1 POLR2A RCOR1 CHD2 SOX11 GC02P006145 LOC400940
GH02I005725 Promoter/Enhancer 1.2 Ensembl ENCODE dbSUPER 11.5 +33.3 33252 1.6 CTCF SP1 POU5F1 BACH1 CTBP2 ENSG00000236106 ENSG00000242540 LINC01248 ENSG00000230090 SOX11 GC02M005657
GH02I005076 Enhancer 0.4 ENCODE 9.4 -615.1 -615126 1.9 CTCF MNT RFX5 SOX11 GC02M005088 RNU6-649P
GH02I005064 Enhancer 0.2 ENCODE 7.5 -627.7 -627671 1.1 SOX11 GC02M005088 RNU6-649P
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SOX11 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SOX11 gene promoter:

Genomic Locations for SOX11 Gene

Genomic Locations for SOX11 Gene
chr2:5,692,667-5,701,385
(GRCh38/hg38)
Size:
8,719 bases
Orientation:
Plus strand
chr2:5,832,799-5,841,517
(GRCh37/hg19)

Genomic View for SOX11 Gene

Genes around SOX11 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SOX11 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SOX11 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SOX11 Gene

Proteins for SOX11 Gene

  • Protein details for SOX11 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P35716-SOX11_HUMAN
    Recommended name:
    Transcription factor SOX-11
    Protein Accession:
    P35716
    Secondary Accessions:
    • Q4ZFV8

    Protein attributes for SOX11 Gene

    Size:
    441 amino acids
    Molecular mass:
    46679 Da
    Quaternary structure:
    No Data Available

neXtProt entry for SOX11 Gene

Post-translational modifications for SOX11 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for SOX11 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for SOX11 Gene

Domains & Families for SOX11 Gene

Gene Families for SOX11 Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins
  • Transcription factors

Protein Domains for SOX11 Gene

Suggested Antigen Peptide Sequences for SOX11 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with SOX11: view

No data available for UniProtKB/Swiss-Prot for SOX11 Gene

Function for SOX11 Gene

Molecular function for SOX11 Gene

GENATLAS Biochemistry:
SRY related HMG box gene 11,expressed in the developing central and peripheral nervous system,somites,developing limbs,facial mesenchyme,kidney,lung,specific postmitotic neuronal subpopulation,modulator of LINE retroposons promoter activity
UniProtKB/Swiss-Prot Function:
Transcriptional factor involved in the embryonic neurogenesis. May also have a role in tissue modeling during development.

Phenotypes From GWAS Catalog for SOX11 Gene

Gene Ontology (GO) - Molecular Function for SOX11 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000976 transcription regulatory region sequence-specific DNA binding IEA,ISS --
GO:0000979 RNA polymerase II core promoter sequence-specific DNA binding IDA 21124928
GO:0001077 transcriptional activator activity, RNA polymerase II proximal promoter sequence-specific DNA binding IEA,ISS --
GO:0001105 RNA polymerase II transcription coactivator activity IEA,ISS --
GO:0001158 enhancer sequence-specific DNA binding IDA,IEA 19808959
genes like me logo Genes that share ontologies with SOX11: view
genes like me logo Genes that share phenotypes with SOX11: view

Human Phenotype Ontology for SOX11 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for SOX11 Gene

MGI Knock Outs for SOX11:

Animal Model Products

CRISPR Products

Inhibitory RNA Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for SOX11 Gene

Localization for SOX11 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SOX11 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SOX11 gene
Compartment Confidence
nucleus 5
cytosol 2

Gene Ontology (GO) - Cellular Components for SOX11 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA,IDA 17934069
GO:0005737 cytoplasm IDA 17934069
genes like me logo Genes that share ontologies with SOX11: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for SOX11 Gene

Pathways & Interactions for SOX11 Gene

genes like me logo Genes that share pathways with SOX11: view

Pathways by source for SOX11 Gene

1 BioSystems pathway for SOX11 Gene
1 Qiagen pathway for SOX11 Gene

Interacting Proteins for SOX11 Gene

Gene Ontology (GO) - Biological Process for SOX11 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription by RNA polymerase II IDA 19808959
GO:0001501 skeletal system development IEA,ISS --
GO:0001822 kidney development IEA --
GO:0001841 neural tube formation ISS,IEA --
GO:0002089 lens morphogenesis in camera-type eye ISS,IEA --
genes like me logo Genes that share ontologies with SOX11: view

No data available for SIGNOR curated interactions for SOX11 Gene

Drugs & Compounds for SOX11 Gene

No Compound Related Data Available

Transcripts for SOX11 Gene

mRNA/cDNA for SOX11 Gene

(1) REFSEQ mRNAs :
(5) Additional mRNA sequences :
(96) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for SOX11 Gene

SRY (sex determining region Y)-box 11:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Alternative Splicing Database (ASD) splice patterns (SP) for SOX11 Gene

No ASD Table

Relevant External Links for SOX11 Gene

GeneLoc Exon Structure for
SOX11
ECgene alternative splicing isoforms for
SOX11

Expression for SOX11 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SOX11 Gene

mRNA differential expression in normal tissues according to GTEx for SOX11 Gene

This gene is overexpressed in Brain - Nucleus accumbens (basal ganglia) (x6.3), Brain - Hypothalamus (x5.8), Brain - Caudate (basal ganglia) (x4.5), Brain - Amygdala (x4.3), and Brain - Putamen (basal ganglia) (x4.1).

Protein differential expression in normal tissues from HIPED for SOX11 Gene

This gene is overexpressed in Adipocyte (24.4), Pancreatic juice (15.1), Fetal Brain (13.3), and Adrenal (10.4).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for SOX11 Gene



NURSA nuclear receptor signaling pathways regulating expression of SOX11 Gene:

SOX11

SOURCE GeneReport for Unigene cluster for SOX11 Gene:

Hs.432638

mRNA Expression by UniProt/SwissProt for SOX11 Gene:

P35716-SOX11_HUMAN
Tissue specificity: Expressed mainly in the nervous system, brain (fetus and adult) and hear (adult).

Evidence on tissue expression from TISSUES for SOX11 Gene

  • Nervous system(4.7)

Phenotype-based relationships between genes and organs from Gene ORGANizer for SOX11 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • immune
  • integumentary
  • nervous
  • reproductive
  • respiratory
  • skeletal muscle
  • skeleton
  • urinary
Regions:
Head and neck:
  • brain
  • cerebellum
  • cheek
  • chin
  • cranial nerve
  • ear
  • eye
  • eyelid
  • face
  • forehead
  • head
  • jaw
  • lip
  • mandible
  • maxilla
  • mouth
  • neck
  • nose
  • outer ear
  • pharynx
  • scalp
  • skull
  • tooth
Thorax:
  • chest wall
  • clavicle
  • diaphragm
  • esophagus
  • heart
  • heart valve
  • lung
  • rib
  • rib cage
  • scapula
  • sternum
Abdomen:
  • abdominal wall
  • biliary tract
  • duodenum
  • intestine
  • kidney
  • large intestine
  • liver
  • pancreas
  • small intestine
  • stomach
Pelvis:
  • pelvis
  • penis
  • rectum
  • testicle
  • ureter
  • urethra
  • uterus
Limb:
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • nail
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
General:
  • blood
  • blood vessel
  • hair
  • peripheral nervous system
  • skin
  • spinal column
  • spinal cord
  • vertebrae
  • white blood cell
genes like me logo Genes that share expression patterns with SOX11: view

Primer Products

No data available for Protein tissue co-expression partners for SOX11 Gene

Orthologs for SOX11 Gene

This gene was present in the common ancestor of animals.

Orthologs for SOX11 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia SOX11 34 33
  • 99.58 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Sox11 33 16 34
  • 86.29 (n)
rat
(Rattus norvegicus)
Mammalia Sox11 33
  • 86.13 (n)
oppossum
(Monodelphis domestica)
Mammalia SOX11 34
  • 79 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia SOX11 34
  • 69 (a)
OneToOne
chicken
(Gallus gallus)
Aves SOX11 33 34
  • 78.4 (n)
lizard
(Anolis carolinensis)
Reptilia SOX11 34
  • 78 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia sox11 33
  • 71.84 (n)
Str.6881 33
African clawed frog
(Xenopus laevis)
Amphibia Xl.891 33
zebrafish
(Danio rerio)
Actinopterygii sox11a 33 34
  • 69.68 (n)
sox11b 34
  • 68 (a)
OneToMany
-- 33
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.11903 33
fruit fly
(Drosophila melanogaster)
Insecta Sox14 34
  • 17 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea sem-2 34
  • 25 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea CSA.10865 34
  • 20 (a)
OneToMany
Species where no ortholog for SOX11 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • cow (Bos Taurus)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for SOX11 Gene

ENSEMBL:
Gene Tree for SOX11 (if available)
TreeFam:
Gene Tree for SOX11 (if available)

Paralogs for SOX11 Gene

(15) SIMAP similar genes for SOX11 Gene using alignment to 3 proteins:

genes like me logo Genes that share paralogs with SOX11: view

Variants for SOX11 Gene

Sequence variations from dbSNP and Humsavar for SOX11 Gene

SNP ID Clin Chr 02 pos Variation AA Info Type
rs1057518672 pathogenic, Mental retardation, autosomal dominant 27 5,694,007(+) G/A coding_sequence_variant, stop_gained
rs587777479 pathogenic, Mental retardation, autosomal dominant 27, Mental retardation, autosomal dominant 27 (MRD27) [MIM:615866] 5,693,068(+) A/G coding_sequence_variant, missense_variant
rs587777480 pathogenic, Mental retardation, autosomal dominant 27, Mental retardation, autosomal dominant 27 (MRD27) [MIM:615866] 5,692,899(+) T/C coding_sequence_variant, missense_variant
rs751221446 uncertain-significance, benign, likely-benign, not provided, not specified 5,693,753(+) CAGCAGCAGCGGCAGCAGCAGCGGCAGCAGC/CAGCAGCAGCGGCAGCAGC/CAGCAGCAGCGGCAGCAGCAGCGGCAGCAGCAGCGGCAGCAGC coding_sequence_variant, inframe_deletion, inframe_insertion
rs1057518187 pathogenic, not provided 5,693,315(+) C/A coding_sequence_variant, stop_gained

Structural Variations from Database of Genomic Variants (DGV) for SOX11 Gene

Variant ID Type Subtype PubMed ID
dgv608n67 CNV gain 20364138
dgv609n67 CNV gain 20364138
dgv676e199 CNV deletion 23128226
nsv580866 CNV gain+loss 21841781
nsv828241 CNV gain 20364138
nsv833292 CNV gain+loss 17160897
nsv953442 CNV deletion 24416366

Variation tolerance for SOX11 Gene

Gene Damage Index Score: 0.31; 6.86% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for SOX11 Gene

Human Gene Mutation Database (HGMD)
SOX11
SNPedia medical, phenotypic, and genealogical associations of SNPs for
SOX11

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SOX11 Gene

Disorders for SOX11 Gene

MalaCards: The human disease database

(9) MalaCards diseases for SOX11 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search SOX11 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

SOX11_HUMAN
  • Mental retardation, autosomal dominant 27 (MRD27) [MIM:615866]: A disorder characterized by significantly below average general intellectual functioning associated with impairments in adaptive behavior and manifested during the developmental period. MRD27 patients show dysmorphic facial features, microcephaly, growth deficiency, hypoplastic fifth toenails, and mild intellectual disability. {ECO:0000269 PubMed:24886874}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for SOX11

genes like me logo Genes that share disorders with SOX11: view

No data available for Genatlas for SOX11 Gene

Publications for SOX11 Gene

  1. The human SOX11 gene: cloning, chromosomal assignment and tissue expression. (PMID: 8666406) Jay P … Berta P (Genomics 1995) 2 3 4 22 58
  2. De novo SOX11 mutations cause Coffin-Siris syndrome. (PMID: 24886874) Tsurusaki Y … Matsumoto N (Nature communications 2014) 3 4 58
  3. New loci associated with kidney function and chronic kidney disease. (PMID: 20383146) Köttgen A … Fox CS (Nature genetics 2010) 3 44 58
  4. SOX11 expression is highly specific for mantle cell lymphoma and identifies the cyclin D1-negative subtype. (PMID: 19880778) Mozos A … Campo E (Haematologica 2009) 3 22 58
  5. Strong lymphoid nuclear expression of SOX11 transcription factor defines lymphoblastic neoplasms, mantle cell lymphoma and Burkitt's lymphoma. (PMID: 19880779) Dictor M … Borrebaeck C (Haematologica 2009) 3 22 58

Products for SOX11 Gene

Sources for SOX11 Gene

Content
Loading form....