Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SNORD110 Gene

Subcategory (RNA class) for SNORD110 Gene

snoRNA

Quality Score for this RNA gene is

3

Aliases for SNORD110 Gene

  • Small Nucleolar RNA, C/D Box 110 2 3 5
  • HBII-55 3

External Ids for SNORD110 Gene

ORGUL Members for SNORD110 Gene

Previous GeneCards Identifiers for SNORD110 Gene

  • GC20U900214
  • GC20P002607
  • GC20P002612
  • GC20P002619
  • GC20P002639
  • GC20P002648
  • GC20P002658
  • GC20P002671
  • GC20P002682
  • GC20P002690
  • GC20P002699
  • GC20P002711
  • GC20P002724
  • GC20P002739
  • GC20P002758
  • GC20P002766
  • GC20P002811
  • GC20P002782
  • GC20P002837
  • GC20P002852

Summaries for SNORD110 Gene

GeneCards Summary for SNORD110 Gene

SNORD110 (Small Nucleolar RNA, C/D Box 110) is an RNA Gene, and is affiliated with the snoRNA class.

Additional gene information for SNORD110 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SNORD110 Gene

Genomics for SNORD110 Gene

GeneHancer (GH) Regulatory Elements for SNORD110 Gene

Promoters and enhancers for SNORD110 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH20I002651 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 550.8 -1.0 -1007 4.2 HDGF SMAD1 ZFP64 ARID4B SIN3A DMAP1 ZNF2 YY1 SLC30A9 POLR2B NOP56 GC20M002651 GC20P002878 GC20P002887 GC20P002888 MIR1292 PIR58104 SNORD110 SNORA51 GC20P002881
GH20I002656 Enhancer 0.5 ENCODE 550.8 +1.8 1778 0.2 PAF1 HIC1 POLR2A ZNF837 GC20P002878 GC20P002879 GC20P002880 GC20P002881 GC20P002882 GC20P002883 GC20P002884 GC20P002887 GC20P002888 PIR58104
GH20I002655 Enhancer 0.4 ENCODE 550.8 +1.2 1194 0.2 SSRP1 POLR2A GC20P002878 GC20P002880 GC20P002881 GC20P002882 GC20P002883 GC20P002884 GC20P002885 GC20P002887 GC20P002888 PIR58104
GH20I002751 Promoter/Enhancer 1.2 Ensembl ENCODE 10.4 +97.9 97890 0.6 CTCF KLF11 ZNF792 RB1 NRF1 SIN3A DMAP1 SREBF1 GTF3C2 ZNF335 VPS16 PTPRA PCED1A TMEM239 ENSG00000241690 C20orf141 EBF4 NOP56 SNORD56 SNORD57
GH20I002752 Enhancer 0.8 ENCODE 10.4 +98.7 98728 0.2 KLF17 ZNF76 SIN3A ZNF2 ZNF48 RAD21 ZEB1 ZNF335 GLIS2 ZNF143 VPS16 PTPRA PCED1A ENSG00000241690 TMEM239 C20orf141 EBF4 SNORD57 SNORD86 SNORD56
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SNORD110 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SNORD110 gene promoter:

Genomic Locations for SNORD110 Gene

Genomic Locations for SNORD110 Gene
chr20:2,654,212-2,654,286
(GRCh38/hg38)
Size:
75 bases
Orientation:
Plus strand
chr20:2,634,858-2,634,932
(GRCh37/hg19)

Genomic View for SNORD110 Gene

Genes around SNORD110 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SNORD110 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SNORD110 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SNORD110 Gene

Proteins for SNORD110 Gene

Post-translational modifications for SNORD110 Gene

No Post-translational modifications

No data available for DME Specific Peptides for SNORD110 Gene

Domains & Families for SNORD110 Gene

Gene Families for SNORD110 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with SNORD110: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for SNORD110 Gene

Function for SNORD110 Gene

Animal Model Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for SNORD110 Gene

Localization for SNORD110 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for SNORD110 Gene

Pathways & Interactions for SNORD110 Gene

SuperPathways for SNORD110 Gene

No Data Available

Interacting Proteins for SNORD110 Gene

Gene Ontology (GO) - Biological Process for SNORD110 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for SNORD110 Gene

Drugs & Compounds for SNORD110 Gene

No Compound Related Data Available

Transcripts for SNORD110 Gene

mRNA/cDNA for SNORD110 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for SNORD110 Gene

No ASD Table

Relevant External Links for SNORD110 Gene

GeneLoc Exon Structure for
SNORD110
ECgene alternative splicing isoforms for
SNORD110

Expression for SNORD110 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SNORD110 Gene

NURSA nuclear receptor signaling pathways regulating expression of SNORD110 Gene:

SNORD110
genes like me logo Genes that share expression patterns with SNORD110: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for SNORD110 Gene

Orthologs for SNORD110 Gene

This gene was present in the common ancestor of mammals.

Orthologs for SNORD110 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia SNORD110 34
  • 100 (a)
OneToOne
dog
(Canis familiaris)
Mammalia SNORD110 34
  • 99 (a)
OneToOne
cow
(Bos Taurus)
Mammalia SNORD110 34
  • 92 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Snord110 34
  • 88 (a)
OneToOne
Species where no ortholog for SNORD110 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for SNORD110 Gene

ENSEMBL:
Gene Tree for SNORD110 (if available)
TreeFam:
Gene Tree for SNORD110 (if available)

Paralogs for SNORD110 Gene

No data available for Paralogs for SNORD110 Gene

Variants for SNORD110 Gene

Sequence variations from dbSNP and Humsavar for SNORD110 Gene

SNP ID Clin Chr 20 pos Variation AA Info Type
rs909330176 benign, pathogenic, Spinocerebellar ataxia 36 2,652,733(+) GGGCCTGGGCCTGGGCCTGGGCCTG/GGGCCTGGGCCTG/GGGCCTGGGCCTGGGCCTG/GGGCCTGGGCCTGGGCCTGGGCCTGGGCCTG/GGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTG/GGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTG/GGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTG/GGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTG/GGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTG/GGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTG/GGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTG/GGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTG/GGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTG/GGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTGGGCCTG upstream_transcript_variant
rs2073194 likely-benign, not specified 2,653,290(+) T/A/C/G upstream_transcript_variant
rs2273137 likely-benign, not specified 2,654,566(+) A/G downstream_transcript_variant
rs1000029440 -- 2,652,363(+) G/A upstream_transcript_variant
rs1000464675 -- 2,652,464(+) G/A upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for SNORD110 Gene

Variant ID Type Subtype PubMed ID
nsv470535 CNV gain 18288195
nsv1057464 CNV gain 25217958
esv3644998 CNV gain 21293372

Additional Variant Information for SNORD110 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
SNORD110

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for SNORD110 Gene

Disorders for SNORD110 Gene

Additional Disease Information for SNORD110

No disorders were found for SNORD110 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SNORD110 Gene

Publications for SNORD110 Gene

  1. RNomics: an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse. (PMID: 11387227) Hüttenhofer A … Brosius J (The EMBO journal 2001) 2 3 58
  2. Eukaryotic snoRNAs: a paradigm for gene expression flexibility. (PMID: 19446021) Dieci G … Montanini B (Genomics 2009) 3 58

Products for SNORD110 Gene

Sources for SNORD110 Gene

Content
Loading form....