Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SNORA37 Gene

Subcategory (RNA class) for SNORA37 Gene

snoRNA

Quality Score for this RNA gene is

3

Aliases for SNORA37 Gene

  • Small Nucleolar RNA, H/ACA Box 37 2 3 5
  • ACA37 SnoRNA 3
  • ACA37 3

External Ids for SNORA37 Gene

Previous GeneCards Identifiers for SNORA37 Gene

  • GC18M050004
  • GC18M051748
  • GC18M048603

Summaries for SNORA37 Gene

GeneCards Summary for SNORA37 Gene

SNORA37 (Small Nucleolar RNA, H/ACA Box 37) is an RNA Gene, and is affiliated with the snoRNA class.

Additional gene information for SNORA37 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SNORA37 Gene

Genomics for SNORA37 Gene

GeneHancer (GH) Regulatory Elements for SNORA37 Gene

Promoters and enhancers for SNORA37 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH18I054221 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 550.8 -1.2 -1232 3.6 HDGF PKNOX1 ARID4B SIN3A IRF4 YY1 ZNF207 ZNF143 SP3 SP5 MBD2 GC18M054223 GC18M054224 SNORA37
GH18I054220 Enhancer 0.5 ENCODE 550.8 +1.7 1746 1 HDGF PKNOX1 KLF1 POLR2A HLF PRDM4 GC18M054223 GC18M054224 SNORA37 POLI MBD2 ENSG00000264296
GH18I054259 Enhancer 1.2 FANTOM5 Ensembl ENCODE 12.3 -38.8 -38794 3.5 PKNOX1 FOXA2 ZBTB40 BATF IRF4 EGR1 ATF7 RCOR1 FOS BCLAF1 GC18P054260 POLI MBD2 SNORA37 C18orf54
GH18I054250 Enhancer 1.1 Ensembl ENCODE 12.1 -30.4 -30408 5.5 FOXA2 MLX ARID4B FEZF1 DMAP1 IRF4 ETS1 YY1 ATF7 RUNX3 POLI C18orf54 MBD2 SNORA37 STARD6 GC18P054260
GH18I054246 Enhancer 1 Ensembl ENCODE dbSUPER 12.2 -24.9 -24947 2.6 SOX5 ZNF687 FOXA2 EBF1 KMT2B ATF2 SP1 BCL11A TARDBP IKZF1 POLI SNORA37 MBD2 C18orf54 STARD6 ENSG00000264296 GC18P054260
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SNORA37 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SNORA37 gene promoter:

Genomic Locations for SNORA37 Gene

Genomic Locations for SNORA37 Gene
chr18:54,222,284-54,222,412
(GRCh38/hg38)
Size:
129 bases
Orientation:
Minus strand
chr18:51,748,654-51,748,782
(GRCh37/hg19)

Genomic View for SNORA37 Gene

Genes around SNORA37 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SNORA37 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SNORA37 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SNORA37 Gene

Proteins for SNORA37 Gene

Post-translational modifications for SNORA37 Gene

No Post-translational modifications

No data available for DME Specific Peptides for SNORA37 Gene

Domains & Families for SNORA37 Gene

Gene Families for SNORA37 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with SNORA37: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for SNORA37 Gene

Function for SNORA37 Gene

Animal Model Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for SNORA37 Gene

Localization for SNORA37 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for SNORA37 Gene

Pathways & Interactions for SNORA37 Gene

SuperPathways for SNORA37 Gene

No Data Available

Interacting Proteins for SNORA37 Gene

Gene Ontology (GO) - Biological Process for SNORA37 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for SNORA37 Gene

Drugs & Compounds for SNORA37 Gene

No Compound Related Data Available

Transcripts for SNORA37 Gene

mRNA/cDNA for SNORA37 Gene

(2) Additional mRNA sequences :
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for SNORA37 Gene

Small nucleolar RNA, H/ACA box 37:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for SNORA37 Gene

No ASD Table

Relevant External Links for SNORA37 Gene

GeneLoc Exon Structure for
SNORA37
ECgene alternative splicing isoforms for
SNORA37

Expression for SNORA37 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SNORA37 Gene

NURSA nuclear receptor signaling pathways regulating expression of SNORA37 Gene:

SNORA37

SOURCE GeneReport for Unigene cluster for SNORA37 Gene:

Hs.655869
genes like me logo Genes that share expression patterns with SNORA37: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for SNORA37 Gene

Orthologs for SNORA37 Gene

This gene was present in the common ancestor of chordates.

Orthologs for SNORA37 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia SNORA30 34
  • 100 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Snora30 34
  • 82 (a)
ManyToMany
cow
(Bos Taurus)
Mammalia SNORA30 34
  • 80 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia SNORA30 34
  • 67 (a)
ManyToMany
lizard
(Anolis carolinensis)
Reptilia SNORA30 34
  • 54 (a)
OneToMany
zebrafish
(Danio rerio)
Actinopterygii SNORA30 34 34 34 34
  • 53 (a)
ManyToMany
Species where no ortholog for SNORA37 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for SNORA37 Gene

ENSEMBL:
Gene Tree for SNORA37 (if available)
TreeFam:
Gene Tree for SNORA37 (if available)

Paralogs for SNORA37 Gene

No data available for Paralogs for SNORA37 Gene

Variants for SNORA37 Gene

Sequence variations from dbSNP and Humsavar for SNORA37 Gene

SNP ID Clin Chr 18 pos Variation AA Info Type
rs1001565712 -- 54,224,050(-) T/C upstream_transcript_variant
rs1002929606 -- 54,224,221(-) GCCGCCGC/GCCGCCGCCGCAGCCGCCGC upstream_transcript_variant
rs1002960842 -- 54,223,953(-) G/C upstream_transcript_variant
rs1004038075 -- 54,224,235(-) CGCCGTCGCCG/CGCCGTCGCCGTCGCCG upstream_transcript_variant
rs1006120452 -- 54,222,727(-) T/G upstream_transcript_variant

Additional Variant Information for SNORA37 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
SNORA37

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) and Variation tolerance for SNORA37 Gene

Disorders for SNORA37 Gene

Additional Disease Information for SNORA37

No disorders were found for SNORA37 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SNORA37 Gene

Publications for SNORA37 Gene

  1. snoRNA-LBME-db, a comprehensive database of human H/ACA and C/D box snoRNAs. (PMID: 16381836) Lestrade L … Weber MJ (Nucleic acids research 2006) 2 3 58
  2. Human box H/ACA pseudouridylation guide RNA machinery. (PMID: 15199136) Kiss AM … Kiss T (Molecular and cellular biology 2004) 2 3 58
  3. Eukaryotic snoRNAs: a paradigm for gene expression flexibility. (PMID: 19446021) Dieci G … Montanini B (Genomics 2009) 3 58

Products for SNORA37 Gene

Sources for SNORA37 Gene

Content
Loading form....