Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SNHG10 Gene

Subcategory (RNA class) for SNHG10 Gene

non-coding RNA

Quality Score for this RNA gene is

3

Aliases for SNHG10 Gene

  • Small Nucleolar RNA Host Gene 10 2 3 5
  • Small Nucleolar RNA Host Gene 10 (Non-Protein Coding) 2 3
  • Long Intergenic Non-Protein Coding RNA 63 2 3
  • Chromosome 14 Open Reading Frame 62 2
  • Non-Protein Coding RNA 63 2
  • NCRNA00063 3
  • LINC00063 3
  • C14orf62 3

External Ids for SNHG10 Gene

Previous HGNC Symbols for SNHG10 Gene

  • C14orf62

Previous GeneCards Identifiers for SNHG10 Gene

  • GC14U900667
  • GC14M095073
  • GC14M096000
  • GC14M076184
  • GC14M096001
  • GC14M096003
  • GC14M096005

Summaries for SNHG10 Gene

Entrez Gene Summary for SNHG10 Gene

  • This gene is small nucleolar RNA host gene 10 and represents a non-protein coding RNA. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2013]

GeneCards Summary for SNHG10 Gene

SNHG10 (Small Nucleolar RNA Host Gene 10) is an RNA Gene, and is affiliated with the non-coding RNA class.

Additional gene information for SNHG10 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SNHG10 Gene

Genomics for SNHG10 Gene

GeneHancer (GH) Regulatory Elements for SNHG10 Gene

Promoters and enhancers for SNHG10 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH14I095530 Promoter/Enhancer 2.5 EPDnew Ensembl ENCODE dbSUPER 560.9 0.0 -3 8.8 PKNOX1 CLOCK FOXA2 MLX ARNT ARID4B NEUROD1 SIN3A DMAP1 ZNF2 GLRX5 SCARNA13 SNHG10 GC14M095530 GC14M095534 PAPOLA LOC101929107 DICER1
GH14I095290 Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 92.6 +243.2 243208 2.4 PKNOX1 SMAD1 ZFP64 NCOA2 ZNF121 ATF7 ZNF214 RXRA ZNF662 ZNF491 SNHG10 SCARNA13 DICER1 CLMN BDKRB1 ENSG00000258615
GH14I095260 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 64.6 +270.7 270703 7.5 PKNOX1 FOXA2 SMAD1 ARID4B SIN3A IRF4 YY1 ZNF143 FOS DEK SNHG10 SCARNA13 CLMN DICER1 ENSG00000258615
GH14I095254 Enhancer 1.3 Ensembl ENCODE dbSUPER 31.4 +279.1 279146 2.2 INSM2 KLF17 FEZF1 GLIS2 ZNF366 ZSCAN5C SCRT2 ZNF143 ZNF548 ETV6 SNHG10 CLMN SCARNA13 DICER1 ENSG00000258615
GH14I094597 Enhancer 1.7 FANTOM5 Ensembl ENCODE dbSUPER 20.1 +934.7 934668 6.1 FOXA2 MLX ZFP64 ARID4B SIN3A DMAP1 YY1 SLC30A9 FOS SP5 SERPINA10 SERPINA3 SERPINA1 SERPINA5 SCARNA13 SNHG10 DICER1 SERPINA6 SERPINA11 SERPINA4
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SNHG10 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SNHG10 gene promoter:

Genomic Locations for SNHG10 Gene

Genomic Locations for SNHG10 Gene
chr14:95,532,297-95,534,872
(GRCh38/hg38)
Size:
2,576 bases
Orientation:
Minus strand
chr14:95,998,634-96,001,209
(GRCh37/hg19)

Genomic View for SNHG10 Gene

Genes around SNHG10 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SNHG10 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SNHG10 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SNHG10 Gene

Proteins for SNHG10 Gene

Post-translational modifications for SNHG10 Gene

No Post-translational modifications

No data available for DME Specific Peptides for SNHG10 Gene

Domains & Families for SNHG10 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for SNHG10 Gene

Function for SNHG10 Gene

Phenotypes From GWAS Catalog for SNHG10 Gene

Animal Model Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for SNHG10 Gene

Localization for SNHG10 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for SNHG10 Gene

Pathways & Interactions for SNHG10 Gene

SuperPathways for SNHG10 Gene

No Data Available

Interacting Proteins for SNHG10 Gene

Gene Ontology (GO) - Biological Process for SNHG10 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for SNHG10 Gene

Drugs & Compounds for SNHG10 Gene

No Compound Related Data Available

Transcripts for SNHG10 Gene

mRNA/cDNA for SNHG10 Gene

(5) Additional mRNA sequences :
(4) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for SNHG10 Gene

Small nucleolar RNA host gene 10 (non-protein coding):
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for SNHG10 Gene

No ASD Table

Relevant External Links for SNHG10 Gene

GeneLoc Exon Structure for
SNHG10
ECgene alternative splicing isoforms for
SNHG10

Expression for SNHG10 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SNHG10 Gene

NURSA nuclear receptor signaling pathways regulating expression of SNHG10 Gene:

SNHG10

SOURCE GeneReport for Unigene cluster for SNHG10 Gene:

Hs.448753
genes like me logo Genes that share expression patterns with SNHG10: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for SNHG10 Gene

Orthologs for SNHG10 Gene

Evolution for SNHG10 Gene

ENSEMBL:
Gene Tree for SNHG10 (if available)
TreeFam:
Gene Tree for SNHG10 (if available)

No data available for Orthologs for SNHG10 Gene

Paralogs for SNHG10 Gene

No data available for Paralogs for SNHG10 Gene

Variants for SNHG10 Gene

Sequence variations from dbSNP and Humsavar for SNHG10 Gene

SNP ID Clin Chr 14 pos Variation AA Info Type
rs121908584 pathogenic, Anemia, sideroblastic, pyridoxine-refractory, autosomal recessive 95,535,383(-) A/G upstream_transcript_variant
rs869320757 pathogenic, Spasticity, childhood-onset, with hyperglycinemia 95,535,236(-) GAAGAAG/GAAG upstream_transcript_variant
rs869320758 pathogenic, Spasticity, childhood-onset, with hyperglycinemia 95,535,169(-) CGGGCGTGCGGGCG/CGGGCGTGCGGGCGTGCGGGCG upstream_transcript_variant
rs1057524469 likely-benign, not specified 95,535,170(-) G/C upstream_transcript_variant
rs554961847 likely-benign, not specified 95,535,074(-) C/T upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for SNHG10 Gene

Variant ID Type Subtype PubMed ID
nsv565631 CNV gain 21841781
nsv1042858 CNV gain 25217958
esv3635400 CNV gain 21293372
dgv89e55 CNV gain 17911159

Additional Variant Information for SNHG10 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
SNHG10

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for SNHG10 Gene

Disorders for SNHG10 Gene

Additional Disease Information for SNHG10

No disorders were found for SNHG10 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SNHG10 Gene

Publications for SNHG10 Gene

  1. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg RL … Mammalian Gene Collection Program Team (Proceedings of the National Academy of Sciences of the United States of America 2002) 2 3 58
  2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 58
  3. Normalization and subtraction: two approaches to facilitate gene discovery. (PMID: 8889548) Bonaldo MF … Soares MB (Genome research 1996) 3 58

Products for SNHG10 Gene

Sources for SNHG10 Gene

Content
Loading form....