Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SLX4IP Gene

Aliases for SLX4IP Gene

  • SLX4 Interacting Protein 2 3 5
  • C20orf94 3 4
  • Chromosome 20 Open Reading Frame 94 2
  • SLX4-Interacting Protein 4
  • Protein SLX4IP 3
  • DJ1099D15.3 3
  • BA204H22.1 3
  • BA254M13.1 3

External Ids for SLX4IP Gene

Previous HGNC Symbols for SLX4IP Gene

  • C20orf94

Summaries for SLX4IP Gene

GeneCards Summary for SLX4IP Gene

SLX4IP (SLX4 Interacting Protein) is a Protein Coding gene. Diseases associated with SLX4IP include Lymphoblastic Leukemia.

Additional gene information for SLX4IP Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SLX4IP Gene

Genomics for SLX4IP Gene

GeneHancer (GH) Regulatory Elements for SLX4IP Gene

Promoters and enhancers for SLX4IP Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH20I010432 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 550.8 +0.0 26 3.5 HDGF PKNOX1 FOXA2 SMAD1 MLX ZFP64 ARID4B NEUROD1 SIN3A YBX1 MKKS SLX4IP LOC100421490 GC20P010506
GH20I010442 Promoter 0.5 EPDnew 550.4 +7.6 7591 0.1 SLX4IP GC20P010506
GH20I010539 Enhancer 1.3 Ensembl ENCODE dbSUPER 11.1 +106.4 106380 3.1 FOXA2 MLX ARID4B YBX1 DMAP1 ETS1 SLC30A9 FOS NFYC REST MKKS SLX4IP GC20P010506 LOC100421490
GH20I010536 Enhancer 1 Ensembl ENCODE dbSUPER 11.2 +102.3 102250 0.4 ELF3 GATAD2A CTCF RFX1 ZNF792 TRIM22 RAD21 ZNF547 SMC3 HNF4A SLX4IP MKKS JAG1 GC20P010506 LOC100421490
GH20I010490 Enhancer 1 FANTOM5 Ensembl ENCODE 10.9 +56.3 56346 1.1 ATM SP1 HLF MAX SLX4IP MKKS GC20P010506
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SLX4IP on UCSC Golden Path with GeneCards custom track

Genomic Locations for SLX4IP Gene

Genomic Locations for SLX4IP Gene
chr20:10,434,547-10,638,546
(GRCh38/hg38)
Size:
204,000 bases
Orientation:
Plus strand
chr20:10,415,951-10,617,477
(GRCh37/hg19)

Genomic View for SLX4IP Gene

Genes around SLX4IP on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SLX4IP Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SLX4IP Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SLX4IP Gene

Proteins for SLX4IP Gene

  • Protein details for SLX4IP Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q5VYV7-SLX4I_HUMAN
    Recommended name:
    Protein SLX4IP
    Protein Accession:
    Q5VYV7
    Secondary Accessions:
    • Q05CG2
    • Q05CT9

    Protein attributes for SLX4IP Gene

    Size:
    408 amino acids
    Molecular mass:
    45552 Da
    Quaternary structure:
    • Interacts with SLX4/BTBD12; subunit of different structure-specific endonucleases.
    SequenceCaution:
    • Sequence=AAH20787.1; Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A sequence.; Evidence={ECO:0000305}; Sequence=AAH26094.1; Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A sequence.; Evidence={ECO:0000305};

neXtProt entry for SLX4IP Gene

Post-translational modifications for SLX4IP Gene

No Post-translational modifications

No data available for DME Specific Peptides for SLX4IP Gene

Domains & Families for SLX4IP Gene

Gene Families for SLX4IP Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for SLX4IP Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for SLX4IP Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q5VYV7

UniProtKB/Swiss-Prot:

SLX4I_HUMAN :
  • Belongs to the SLX4IP family.
Family:
  • Belongs to the SLX4IP family.
genes like me logo Genes that share domains with SLX4IP: view

Function for SLX4IP Gene

Phenotypes From GWAS Catalog for SLX4IP Gene

Gene Ontology (GO) - Molecular Function for SLX4IP Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 19596235
genes like me logo Genes that share ontologies with SLX4IP: view

Phenotypes for SLX4IP Gene

genes like me logo Genes that share phenotypes with SLX4IP: view

Animal Models for SLX4IP Gene

MGI Knock Outs for SLX4IP:

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for SLX4IP Gene

Localization for SLX4IP Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SLX4IP gene
Compartment Confidence
cytosol 3
nucleus 2
extracellular 1
peroxisome 1

Subcellular locations from the

Human Protein Atlas (HPA)

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for SLX4IP Gene

Pathways & Interactions for SLX4IP Gene

SuperPathways for SLX4IP Gene

No Data Available

Gene Ontology (GO) - Biological Process for SLX4IP Gene

None

No data available for Pathways by source and SIGNOR curated interactions for SLX4IP Gene

Drugs & Compounds for SLX4IP Gene

No Compound Related Data Available

Transcripts for SLX4IP Gene

Unigene Clusters for SLX4IP Gene

SLX4 interacting protein:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for SLX4IP Gene

No ASD Table

Relevant External Links for SLX4IP Gene

GeneLoc Exon Structure for
SLX4IP
ECgene alternative splicing isoforms for
SLX4IP

Expression for SLX4IP Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SLX4IP Gene

Protein differential expression in normal tissues from HIPED for SLX4IP Gene

This gene is overexpressed in Kidney (67.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for SLX4IP Gene



NURSA nuclear receptor signaling pathways regulating expression of SLX4IP Gene:

SLX4IP

SOURCE GeneReport for Unigene cluster for SLX4IP Gene:

Hs.668782
genes like me logo Genes that share expression patterns with SLX4IP: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for SLX4IP Gene

Orthologs for SLX4IP Gene

This gene was present in the common ancestor of chordates.

Orthologs for SLX4IP Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia SLX4IP 33 34
  • 99.35 (n)
dog
(Canis familiaris)
Mammalia SLX4IP 33 34
  • 89.11 (n)
rat
(Rattus norvegicus)
Mammalia Slx4ip 33
  • 82.42 (n)
mouse
(Mus musculus)
Mammalia Slx4ip 33 16 34
  • 82.18 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 74 (a)
OneToMany
-- 34
  • 51 (a)
OneToMany
cow
(Bos Taurus)
Mammalia SLX4IP 34
  • 70 (a)
OneToOne
chicken
(Gallus gallus)
Aves C3H20ORF94 33 34
  • 60.84 (n)
lizard
(Anolis carolinensis)
Reptilia SLX4IP 34
  • 54 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia slx4ip 33
  • 55.4 (n)
zebrafish
(Danio rerio)
Actinopterygii slx4ip 34
  • 21 (a)
OneToOne
Species where no ortholog for SLX4IP was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for SLX4IP Gene

ENSEMBL:
Gene Tree for SLX4IP (if available)
TreeFam:
Gene Tree for SLX4IP (if available)

Paralogs for SLX4IP Gene

No data available for Paralogs for SLX4IP Gene

Variants for SLX4IP Gene

Sequence variations from dbSNP and Humsavar for SLX4IP Gene

SNP ID Clin Chr 20 pos Variation AA Info Type
rs16996729 benign, Bardet-Biedl syndrome 10,434,133(+) CAGGCCGCCAC/CAGGCCGCCACAGGCCGCCAC upstream_transcript_variant
rs1000006587 -- 10,503,348(+) G/A genic_upstream_transcript_variant, intron_variant
rs1000019716 -- 10,538,724(+) A/C genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1000040488 -- 10,491,029(+) AA/ genic_upstream_transcript_variant, intron_variant
rs1000073403 -- 10,552,282(+) C/T genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for SLX4IP Gene

Variant ID Type Subtype PubMed ID
nsv962556 CNV duplication 23825009
nsv833920 CNV gain 17160897
nsv522874 CNV loss 19592680
nsv507905 OTHER sequence alteration 20534489
nsv507904 OTHER sequence alteration 20534489
nsv1136506 CNV deletion 24896259

Variation tolerance for SLX4IP Gene

Residual Variation Intolerance Score: 59.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.07; 68.89% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for SLX4IP Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
SLX4IP

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SLX4IP Gene

Disorders for SLX4IP Gene

MalaCards: The human disease database

(1) MalaCards diseases for SLX4IP Gene - From: DISEASES and GeneCards

Disorder Aliases PubMed IDs
lymphoblastic leukemia
  • leukemia, lymphoid
- elite association - COSMIC cancer census association via MalaCards

UniProtKB/Swiss-Prot

SLX4I_HUMAN
  • Note=Chromosomal aberrations involving SLX4IP are found in acute lymphoblastic leukemia. A site-specific deletion within the 5 region of SLX4IP is found in 30% of childhood acute lymphoblastic leukemia in general and more than 60% of ETV6/RUNX1-rearranged acute lymphoblastic leukemia. Breakpoints within SLX4IP reveal junctions with typical characteristics of illegitimate V(D)J mediated recombination. SLX4IP deletions are significantly associated with male gender and ETV6/RUNX1-rearranged acute lymphoblastic leukemia. {ECO:0000269 PubMed:24045615}.

Additional Disease Information for SLX4IP

genes like me logo Genes that share disorders with SLX4IP: view

No data available for Genatlas for SLX4IP Gene

Publications for SLX4IP Gene

  1. Mammalian BTBD12/SLX4 assembles a Holliday junction resolvase and is required for DNA repair. (PMID: 19596235) Svendsen JM … Harper JW (Cell 2009) 2 3 4 58
  2. Frequent and sex-biased deletion of SLX4IP by illegitimate V(D)J-mediated recombination in childhood acute lymphoblastic leukemia. (PMID: 24045615) Meissner B … Stanulla M (Human molecular genetics 2014) 3 4 58
  3. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 58
  4. Site-specific mapping of the human SUMO proteome reveals co-modification with phosphorylation. (PMID: 28112733) Hendriks IA … Nielsen ML (Nature structural & molecular biology 2017) 4 58
  5. Noncovalent interactions with SUMO and ubiquitin orchestrate distinct functions of the SLX4 complex in genome maintenance. (PMID: 25533185) Ouyang J … Zou L (Molecular cell 2015) 3 58

Products for SLX4IP Gene

Sources for SLX4IP Gene

Content
Loading form....