Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SLC36A3 Gene

Aliases for SLC36A3 Gene

  • Solute Carrier Family 36 Member 3 2 3 4 5
  • Proton/Amino Acid Transporter 3 3 4
  • TRAMD2 3 4
  • PAT3 3 4
  • Solute Carrier Family 36 (Proton/Amino Acid Symporter), Member 3 3
  • Proton-Coupled Amino Acid Transporter 3 3
  • Solute Carrier Family 36, Member 3 2
  • Tramdorin 2 3
  • Tramdorin-2 4
  • Tramdorin2 3

External Ids for SLC36A3 Gene

Previous GeneCards Identifiers for SLC36A3 Gene

  • GC05M150647
  • GC05M150684
  • GC05M150636
  • GC05M145801

Summaries for SLC36A3 Gene

GeneCards Summary for SLC36A3 Gene

SLC36A3 (Solute Carrier Family 36 Member 3) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include proton transmembrane transporter activity and glycine transmembrane transporter activity. An important paralog of this gene is SLC36A1.

Additional gene information for SLC36A3 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SLC36A3 Gene

Genomics for SLC36A3 Gene

GeneHancer (GH) Regulatory Elements for SLC36A3 Gene

Promoters and enhancers for SLC36A3 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH05J151303 Promoter 0.5 EPDnew 650.4 +9.2 9195 0.1 SLC36A3 CCDC69
GH05J151595 Enhancer 0.6 FANTOM5 dbSUPER 30.7 -282.3 -282311 0.3 EGR2 SLC36A3 FAT2 SPARC LOC105378231 MIR6499
GH05J151706 Enhancer 1.4 FANTOM5 Ensembl ENCODE dbSUPER 4.5 -395.2 -395170 2.7 HDAC1 ELF3 ATF1 FOXA2 NFRKB CEBPG E4F1 RARA YY1 FOSL1 SPARC CLMAT3 SLC36A3 RN7SKP232 ENSG00000272112
GH05J151250 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 0.2 +57.7 57685 9 HDGF PKNOX1 FOXA2 SMAD1 ARNT ARID4B SIN3A DMAP1 ZNF2 IRF4 GM2A ANXA6 SLC36A1 TNIP1 CCDC69 DCTN4 SMIM3 SLC36A3
GH05J151233 Enhancer 1.3 Ensembl ENCODE dbSUPER 0.2 +78.3 78336 2.4 FOXA2 ARID4B DMAP1 ZNF48 YY1 ZNF207 ZNF143 ZFP91 RUNX3 RXRA GM2A CCDC69 SLC36A3
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SLC36A3 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SLC36A3 gene promoter:
  • E2F-5
  • E2F
  • E2F-1
  • E2F-2
  • E2F-3a
  • E2F-4
  • SREBP-1c
  • SREBP-1b
  • SREBP-1a
  • Meis-1

Genomic Locations for SLC36A3 Gene

Genomic Locations for SLC36A3 Gene
chr5:151,276,365-151,312,981
(GRCh38/hg38)
Size:
36,617 bases
Orientation:
Minus strand
chr5:150,655,926-150,683,334
(GRCh37/hg19)
Size:
27,409 bases
Orientation:
Minus strand

Genomic View for SLC36A3 Gene

Genes around SLC36A3 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SLC36A3 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SLC36A3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SLC36A3 Gene

Proteins for SLC36A3 Gene

  • Protein details for SLC36A3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q495N2-S36A3_HUMAN
    Recommended name:
    Proton-coupled amino acid transporter 3
    Protein Accession:
    Q495N2
    Secondary Accessions:
    • Q495N3
    • Q6ZMU7
    • Q6ZRU4
    • Q7Z6B4

    Protein attributes for SLC36A3 Gene

    Size:
    470 amino acids
    Molecular mass:
    51735 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for SLC36A3 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for SLC36A3 Gene

Post-translational modifications for SLC36A3 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for SLC36A3 Gene

Domains & Families for SLC36A3 Gene

Gene Families for SLC36A3 Gene

HGNC:
IUPHAR :
Human Protein Atlas (HPA):
  • Predicted membrane proteins
  • Transporters

Protein Domains for SLC36A3 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for SLC36A3 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q495N2

UniProtKB/Swiss-Prot:

S36A3_HUMAN :
  • Belongs to the amino acid/polyamine transporter 2 family.
Family:
  • Belongs to the amino acid/polyamine transporter 2 family.
genes like me logo Genes that share domains with SLC36A3: view

Function for SLC36A3 Gene

Phenotypes From GWAS Catalog for SLC36A3 Gene

Gene Ontology (GO) - Molecular Function for SLC36A3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005280 amino acid:proton symporter activity IBA --
GO:0015078 proton transmembrane transporter activity IBA --
GO:0015171 amino acid transmembrane transporter activity IBA --
GO:0015180 L-alanine transmembrane transporter activity IBA --
GO:0015187 glycine transmembrane transporter activity IBA --
genes like me logo Genes that share ontologies with SLC36A3: view
genes like me logo Genes that share phenotypes with SLC36A3: view

Animal Model Products

  • Taconic Biosciences Mouse Models for SLC36A3

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for SLC36A3 Gene

Localization for SLC36A3 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SLC36A3 Gene

Membrane; Multi-pass membrane protein.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SLC36A3 gene
Compartment Confidence
plasma membrane 4
cytoskeleton 1

Gene Ontology (GO) - Cellular Components for SLC36A3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005774 vacuolar membrane IBA --
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with SLC36A3: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for SLC36A3 Gene

Pathways & Interactions for SLC36A3 Gene

SuperPathways for SLC36A3 Gene

No Data Available

Interacting Proteins for SLC36A3 Gene

Gene Ontology (GO) - Biological Process for SLC36A3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003333 amino acid transmembrane transport IBA --
GO:0015808 L-alanine transport IEA --
GO:0015816 glycine transport IBA --
GO:0035524 proline transmembrane transport IEA --
GO:1902600 proton transmembrane transport IEA --
genes like me logo Genes that share ontologies with SLC36A3: view

No data available for Pathways by source and SIGNOR curated interactions for SLC36A3 Gene

Drugs & Compounds for SLC36A3 Gene

No Compound Related Data Available

Transcripts for SLC36A3 Gene

mRNA/cDNA for SLC36A3 Gene

(8) REFSEQ mRNAs :
(8) Additional mRNA sequences :
(11) Selected AceView cDNA sequences:
(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for SLC36A3 Gene

Solute carrier family 36 (proton/amino acid symporter), member 3:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for SLC36A3 Gene

ExUns: 1a · 1b ^ 2 ^ 3a · 3b ^ 4 ^ 5 ^ 6 ^ 7a · 7b · 7c ^ 8 ^ 9 ^ 10 ^ 11a · 11b
SP1: -
SP2: - -
SP3: - -

Relevant External Links for SLC36A3 Gene

GeneLoc Exon Structure for
SLC36A3
ECgene alternative splicing isoforms for
SLC36A3

Expression for SLC36A3 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SLC36A3 Gene

mRNA differential expression in normal tissues according to GTEx for SLC36A3 Gene

This gene is overexpressed in Testis (x50.4).

NURSA nuclear receptor signaling pathways regulating expression of SLC36A3 Gene:

SLC36A3

SOURCE GeneReport for Unigene cluster for SLC36A3 Gene:

Hs.720893

mRNA Expression by UniProt/SwissProt for SLC36A3 Gene:

Q495N2-S36A3_HUMAN
Tissue specificity: Specifically expressed in testis.
genes like me logo Genes that share expression patterns with SLC36A3: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for SLC36A3 Gene

Orthologs for SLC36A3 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for SLC36A3 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia SLC36A3 34 33
  • 99.15 (n)
OneToOne
cow
(Bos Taurus)
Mammalia SLC36A3 34 33
  • 89.36 (n)
OneToOne
dog
(Canis familiaris)
Mammalia SLC36A3 34 33
  • 88.91 (n)
OneToOne
mouse
(Mus musculus)
Mammalia Slc36a3 16 34 33
  • 82.99 (n)
rat
(Rattus norvegicus)
Mammalia Slc36a3 33
  • 81.57 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 59 (a)
OneToMany
oppossum
(Monodelphis domestica)
Mammalia SLC36A3 34
  • 47 (a)
OneToOne
chicken
(Gallus gallus)
Aves -- 34
  • 54 (a)
OneToMany
lizard
(Anolis carolinensis)
Reptilia -- 34
  • 58 (a)
OneToMany
zebrafish
(Danio rerio)
Actinopterygii slc36a1 34
  • 53 (a)
OneToMany
fruit fly
(Drosophila melanogaster)
Insecta CG13384 34
  • 33 (a)
ManyToMany
CG1139 34
  • 32 (a)
ManyToMany
CG7888 34
  • 31 (a)
ManyToMany
CG16700 34
  • 30 (a)
ManyToMany
CG32079 34
  • 30 (a)
ManyToMany
path 34
  • 28 (a)
ManyToMany
CG8785 34
  • 28 (a)
ManyToMany
CG43693 34
  • 27 (a)
ManyToMany
CG32081 34
  • 27 (a)
ManyToMany
CG4991 34
  • 27 (a)
ManyToMany
CG12943 34
  • 25 (a)
ManyToMany
worm
(Caenorhabditis elegans)
Secernentea Y43F4B.7 34
  • 29 (a)
ManyToMany
T27A1.5 34
  • 28 (a)
ManyToMany
Y38H6C.17 34
  • 26 (a)
ManyToMany
C44B7.6 34
  • 25 (a)
ManyToMany
H32K16.1 34
  • 24 (a)
ManyToMany
F59B2.2 34
  • 22 (a)
ManyToMany
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes AVT4 34
  • 17 (a)
ManyToMany
AVT3 36 34
  • 16 (a)
thale cress
(Arabidopsis thaliana)
eudicotyledons AT2G42005 33
  • 45.02 (n)
rice
(Oryza sativa)
Liliopsida Os04g0565500 33
  • 46.01 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 45 (a)
OneToMany
Species where no ortholog for SLC36A3 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for SLC36A3 Gene

ENSEMBL:
Gene Tree for SLC36A3 (if available)
TreeFam:
Gene Tree for SLC36A3 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for SLC36A3: view image

Paralogs for SLC36A3 Gene

Paralogs for SLC36A3 Gene

(3) SIMAP similar genes for SLC36A3 Gene using alignment to 1 proteins:

  • S36A3_HUMAN
genes like me logo Genes that share paralogs with SLC36A3: view

Variants for SLC36A3 Gene

Sequence variations from dbSNP and Humsavar for SLC36A3 Gene

SNP ID Clin Chr 05 pos Variation AA Info Type
rs1000067087 -- 151,299,243(-) TCTCTCTCTCTCTCTCTCTCTCTAT/T genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1000123410 -- 151,281,556(-) G/A genic_downstream_transcript_variant, intron_variant
rs1000124833 -- 151,293,202(-) T/C genic_upstream_transcript_variant, intron_variant
rs1000153913 -- 151,293,642(-) A/G genic_upstream_transcript_variant, intron_variant
rs1000416778 -- 151,287,681(-) C/T intron_variant

Structural Variations from Database of Genomic Variants (DGV) for SLC36A3 Gene

Variant ID Type Subtype PubMed ID
nsv1032558 CNV loss 25217958
esv6641 CNV loss 19470904

Variation tolerance for SLC36A3 Gene

Residual Variation Intolerance Score: 82% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.60; 72.48% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for SLC36A3 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
SLC36A3

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SLC36A3 Gene

Disorders for SLC36A3 Gene

Additional Disease Information for SLC36A3

No disorders were found for SLC36A3 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SLC36A3 Gene

Publications for SLC36A3 Gene

  1. A cluster of proton/amino acid transporter genes in the human and mouse genomes. (PMID: 12809675) Boll M … Daniel H (Genomics 2003) 2 3 4 58
  2. Organization and expression of the SLC36 cluster of amino acid transporter genes. (PMID: 15058382) Bermingham JR … Pennington J (Mammalian genome : official journal of the International Mammalian Genome Society 2004) 3 4 58
  3. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 58
  4. Evolutionary origin of amino acid transporter families SLC32, SLC36 and SLC38 and physiological, pathological and therapeutic aspects. (PMID: 23506890) Schiöth HB … Fredriksson R (Molecular aspects of medicine 2013) 3 58
  5. Mechanisms of lysophosphatidic acid (LPA) mediated stimulation of intestinal apical Cl-/OH- exchange. (PMID: 19910524) Singla A … Dudeja PK (American journal of physiology. Gastrointestinal and liver physiology 2010) 3 58

Products for SLC36A3 Gene

Sources for SLC36A3 Gene

Content
Loading form....