Free for academic non-profit institutions. Other users need a Commercial license

SIX5 Gene(Protein Coding)

SIX Homeobox 5

GCID:
GC19M045764
GIFtS:
48
Genes Participants
UDN Logo

Aliases for SIX5 Gene

Aliases for SIX5 Gene

  • SIX Homeobox 5 2 3 5
  • DM Locus-Associated Homeodomain Protein 3 4
  • Sine Oculis Homeobox Homolog 5 3 4
  • DMAHP 3 4
  • Dystrophia Myotonica-Associated Homeodomain Protein 3
  • Sine Oculis Homeobox (Drosophila) Homolog 5 2
  • Sine Oculis Homeobox Homolog 5 (Drosophila) 2
  • Homeobox Protein SIX5 3
  • BOR2 3

External Ids for SIX5 Gene

Previous HGNC Symbols for SIX5 Gene

  • DMAHP

Previous GeneCards Identifiers for SIX5 Gene

  • GC19U990028
  • GC19M050959
  • GC19M046268
  • GC19M042696

Summaries for SIX5 Gene

Entrez Gene Summary for SIX5 Gene

  • The protein encoded by this gene is a homeodomain-containing transcription factor that appears to function in the regulation of organogenesis. This gene is located downstream of the dystrophia myotonica-protein kinase gene. Mutations in this gene are a cause of branchiootorenal syndrome type 2. [provided by RefSeq, Jul 2009]

GeneCards Summary for SIX5 Gene

SIX5 (SIX Homeobox 5) is a Protein Coding gene. Diseases associated with SIX5 include Branchiootorenal Syndrome 2 and Branchiootorenal Syndrome. Gene Ontology (GO) annotations related to this gene include sequence-specific DNA binding. An important paralog of this gene is SIX4.

UniProtKB/Swiss-Prot for SIX5 Gene

  • Transcription factor that is thought to be involved in regulation of organogenesis. May be involved in determination and maintenance of retina formation. Binds a 5-GGTGTCAG-3 motif present in the ARE regulatory element of ATP1A1. Binds a 5-TCA[AG][AG]TTNC-3 motif present in the MEF3 element in the myogenin promoter, and in the IGFBP5 promoter (By similarity). Thought to be regulated by association with Dach and Eya proteins, and seems to be coactivated by EYA1, EYA2 and EYA3 (By similarity).

Gene Wiki entry for SIX5 Gene

Additional gene information for SIX5 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SIX5 Gene

Genomics for SIX5 Gene

Products:

  1. Regulatory Element

GeneHancer (GH) Regulatory Elements for SIX5 Gene

Promoters and enhancers for SIX5 Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH19I045763 Promoter/Enhancer 2.5 EPDnew Ensembl ENCODE dbSUPER 550.8 +0.4 397 10.2 CLOCK MLX ZFP64 DMAP1 YY1 SLC30A9 E2F8 ZNF143 SP3 NFYC DM1-AS SIX5 CCDC61 SYMPK FBXO46 ENSG00000268810 CLASRP ENSG00000267114 ENSG00000269148 DMWD
GH19I044844 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 9.8 +921.2 921225 7.3 YBX1 DMAP1 YY1 ZNF213 E2F8 ZNF416 ZNF143 MCM3 SP3 ZNF610 NECTIN2 GC19P044850 ZNF180 ZNF45 ZNF225 CLASRP ZNF224 ZNF234 ZNF284 FBXO46
GH19I045667 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 11.7 +100.7 100670 2.4 HDGF PKNOX1 CLOCK SMAD1 FOXA2 ARNT SIN3A YBX1 ZNF2 POLR2B GIPR SNRPD2 CCDC61 DM1-AS ENSG00000259605 ENSG00000268810 CLASRP FBXO46 PPP1R13L ENSG00000269148
GH19I045715 Promoter/Enhancer 1.6 Ensembl ENCODE 11.8 +51.7 51650 3.4 CLOCK MLX DMAP1 IRF4 YY1 ZNF213 ZNF143 SP3 NFYC GLIS1 ENSG00000279407 ENSG00000268810 SNRPD2 CCDC61 QPCTL SIX5 DMWD ENSG00000269148 CLASRP FBXO46
GH19I045798 Enhancer 1 Ensembl ENCODE 12 -30.1 -30089 0.9 PKNOX1 CLOCK SIN3A ZNF2 ZBTB7B RAD21 ZNF335 GLIS2 EGR1 ZNF143 CLASRP DMWD CCDC61 ENSG00000269148 ENSG00000268810 SIX5 FOXA3 SYMPK FBXO46 PIR50651
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SIX5 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SIX5 gene promoter:

Genomic Locations for SIX5 Gene

Genomic Locations for SIX5 Gene
chr19:45,764,785-45,769,239
(GRCh38/hg38)
Size:
4,455 bases
Orientation:
Minus strand
chr19:46,268,043-46,272,497
(GRCh37/hg19)

Genomic View for SIX5 Gene

Genes around SIX5 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SIX5 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SIX5 Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for SIX5 Gene

Proteins for SIX5 Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for SIX5 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q8N196-SIX5_HUMAN
    Recommended name:
    Homeobox protein SIX5
    Protein Accession:
    Q8N196

    Protein attributes for SIX5 Gene

    Size:
    739 amino acids
    Molecular mass:
    74562 Da
    Quaternary structure:
    • Probably binds DNA dimer. Interacts with EYA3, and probably EYA1 and EYA2 (By similarity).
    SequenceCaution:
    • Sequence=AAH33204.1; Type=Miscellaneous discrepancy; Note=Aberrant splicing.; Evidence={ECO:0000305}; Sequence=AK074826; Type=Erroneous termination; Positions=721; Note=Translated as Glu.; Evidence={ECO:0000305};

neXtProt entry for SIX5 Gene

Protein Expression for SIX5 Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for SIX5 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for SIX5 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for SIX5 Gene

Domains & Families for SIX5 Gene

Gene Families for SIX5 Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins
  • Transcription factors

Protein Domains for SIX5 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for SIX5 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q8N196

UniProtKB/Swiss-Prot:

SIX5_HUMAN :
  • Belongs to the SIX/Sine oculis homeobox family.
Family:
  • Belongs to the SIX/Sine oculis homeobox family.
genes like me logo Genes that share domains with SIX5: view

Function for SIX5 Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for SIX5 Gene

GENATLAS Biochemistry:
Drosophila sine oculis homolog SIX5,myotonic dystrophy (DM) locus-associated homeo box encoding gene,expressed in skeletal muscle,heart and brain,also expressed in eye,especially in lens epithelium,potentially involved in the development of adult onset cataracts frequently observed in DM,homolog to the muscle-specific transcription factor AREC3,inhibited in dystrophia myotonica by CTG repeat expansion in 3-non-coding region of DMPK,abuting its own 5end
UniProtKB/Swiss-Prot Function:
Transcription factor that is thought to be involved in regulation of organogenesis. May be involved in determination and maintenance of retina formation. Binds a 5-GGTGTCAG-3 motif present in the ARE regulatory element of ATP1A1. Binds a 5-TCA[AG][AG]TTNC-3 motif present in the MEF3 element in the myogenin promoter, and in the IGFBP5 promoter (By similarity). Thought to be regulated by association with Dach and Eya proteins, and seems to be coactivated by EYA1, EYA2 and EYA3 (By similarity).

Phenotypes From GWAS Catalog for SIX5 Gene

Gene Ontology (GO) - Molecular Function for SIX5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000978 RNA polymerase II proximal promoter sequence-specific DNA binding IEA --
GO:0003677 DNA binding IEA --
GO:0005515 protein binding IPI 16713569
GO:0043565 sequence-specific DNA binding IEA --
genes like me logo Genes that share ontologies with SIX5: view
genes like me logo Genes that share phenotypes with SIX5: view

Human Phenotype Ontology for SIX5 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for SIX5 Gene

MGI Knock Outs for SIX5:

Animal Model Products

CRISPR Products

Inhibitory RNA Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for SIX5 Gene

Localization for SIX5 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SIX5 Gene

Cytoplasm. Nucleus.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SIX5 gene
Compartment Confidence
nucleus 5
cytosol 3
golgi apparatus 2

Gene Ontology (GO) - Cellular Components for SIX5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA --
GO:0005737 cytoplasm IEA --
genes like me logo Genes that share ontologies with SIX5: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for SIX5 Gene

Pathways & Interactions for SIX5 Gene

SuperPathways for SIX5 Gene

PathCards logo More details on SuperPathways for SIX5
No Data Available

Gene Ontology (GO) - Biological Process for SIX5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0002088 lens development in camera-type eye IEA --
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0007275 multicellular organism development IEA --
GO:0007286 spermatid development IEA --
genes like me logo Genes that share ontologies with SIX5: view

No data available for Pathways by source and SIGNOR curated interactions for SIX5 Gene

Drugs & Compounds for SIX5 Gene

Products:

  1. Drug
No Compound Related Data Available

Transcripts for SIX5 Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for SIX5 Gene

(1) REFSEQ mRNAs :
(3) Additional mRNA sequences :
(311) Selected AceView cDNA sequences:
(4) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for SIX5 Gene

SIX homeobox 5:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Alternative Splicing Database (ASD) splice patterns (SP) for SIX5 Gene

ExUns: 1a · 1b ^ 2 ^ 3a · 3b
SP1:
SP2: -

Relevant External Links for SIX5 Gene

GeneLoc Exon Structure for
SIX5
ECgene alternative splicing isoforms for
SIX5

Expression for SIX5 Gene

Products:

  1. Primer
  2. Gene Expression Assay

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SIX5 Gene

mRNA expression in normal human tissues for SIX5 Gene
mRNA expression by GTEx for SIX5 GenemRNA expression by BioGPS for SIX5 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for SIX5 Gene

This gene is overexpressed in Heart (48.5), Peripheral blood mononuclear cells (10.7), and Brain (8.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for SIX5 Gene



Protein tissue co-expression partners for SIX5 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of SIX5 Gene:

SIX5

SOURCE GeneReport for Unigene cluster for SIX5 Gene:

Hs.43314

mRNA Expression by UniProt/SwissProt for SIX5 Gene:

Q8N196-SIX5_HUMAN
Tissue specificity: Expressed in adult but not in fetal eyes. Found in corneal epithelium and endothelium, lens epithelium, ciliary body epithelia, cellular layers of the retina and the sclera.

Evidence on tissue expression from TISSUES for SIX5 Gene

  • Eye(4.5)
  • Heart(3)
  • Blood(2.4)
  • Kidney(2.4)
  • Nervous system(2.2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for SIX5 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • digestive
  • endocrine
  • immune
  • integumentary
  • nervous
  • skeletal muscle
  • skeleton
  • urinary
Regions:
Head and neck:
  • brain
  • cheek
  • chin
  • cranial nerve
  • ear
  • face
  • head
  • inner ear
  • jaw
  • lacrimal apparatus
  • mandible
  • maxilla
  • middle ear
  • mouth
  • neck
  • nose
  • outer ear
  • pharynx
  • skull
  • thyroid
  • tongue
  • tooth
Thorax:
  • esophagus
Abdomen:
  • biliary tract
  • duodenum
  • intestine
  • kidney
  • large intestine
  • pancreas
  • small intestine
  • stomach
Pelvis:
  • pelvis
  • ureter
  • urinary bladder
Limb:
  • femur
  • hip
  • lower limb
  • thigh
General:
  • peripheral nerve
  • peripheral nervous system
  • skin
genes like me logo Genes that share expression patterns with SIX5: view

Primer Products

No data available for mRNA differential expression in normal tissues for SIX5 Gene

Orthologs for SIX5 Gene

This gene was present in the common ancestor of animals.

Orthologs for SIX5 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia SIX5 33 34
  • 99.53 (n)
dog
(Canis familiaris)
 Mammalia SIX5 33 34
  • 88.79 (n)
cow
(Bos Taurus)
 Mammalia SIX5 33 34
  • 88.5 (n)
platypus
(Ornithorhynchus anatinus)
 Mammalia SIX5 34
  • 86 (a)
 OneToOne
mouse
(Mus musculus)
 Mammalia Six5 33 16 34
  • 84.19 (n)
rat
(Rattus norvegicus)
 Mammalia Six5 33
  • 83.96 (n)
lizard
(Anolis carolinensis)
 Reptilia -- 34
  • 39 (a)
 ManyToMany
zebrafish
(Danio rerio)
 Actinopterygii six4.3 34
  • 32 (a)
 OneToOne
fruit fly
(Drosophila melanogaster)
 Insecta Six4 34
  • 33 (a)
 OneToMany
Species where no ortholog for SIX5 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for SIX5 Gene

ENSEMBL:
Gene Tree for SIX5 (if available)
TreeFam:
Gene Tree for SIX5 (if available)

Paralogs for SIX5 Gene

Paralogs for SIX5 Gene

(6) SIMAP similar genes for SIX5 Gene using alignment to 3 proteins:

genes like me logo Genes that share paralogs with SIX5: view

Variants for SIX5 Gene

Products:

  1. SNP Genotyping and Copy Number Assay

Sequence variations from dbSNP and Humsavar for SIX5 Gene

SNP ID Clin Chr 19 pos Variation AA Info Type
rs1057519372 uncertain-significance, Branchiootorenal syndrome 2 45,766,698(-) C/T coding_sequence_variant, missense_variant
rs55938914 pathogenic, Steinert myotonic dystrophy syndrome 45,770,205(-) CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA upstream_transcript_variant
rs80356461 pathogenic, Branchiootorenal syndrome 2, Branchiootorenal syndrome 2 (BOR2) [MIM:610896] 45,768,373(-) C/T coding_sequence_variant, missense_variant
rs80356462 pathogenic, Branchiootorenal syndrome 2, Branchiootorenal syndrome 2 (BOR2) [MIM:610896] 45,767,073(-) C/T coding_sequence_variant, missense_variant
rs80356463 pathogenic, Branchiootorenal syndrome 2, Branchiootorenal syndrome 2 (BOR2) [MIM:610896] 45,766,866(-) C/T coding_sequence_variant, missense_variant

Structural Variations from Database of Genomic Variants (DGV) for SIX5 Gene

Variant ID Type Subtype PubMed ID
nsv579870 CNV loss 21841781

Variation tolerance for SIX5 Gene

Gene Damage Index Score: 8.76; 86.70% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for SIX5 Gene

Human Gene Mutation Database (HGMD)
SIX5
SNPedia medical, phenotypic, and genealogical associations of SNPs for
SIX5

SNP Genotyping and Copy Number Assay Products

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SIX5 Gene

Disorders for SIX5 Gene

MalaCards: The human disease database

(13) MalaCards diseases for SIX5 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
branchiootorenal syndrome 2
  • bor2
branchiootorenal syndrome
  • branchio-oto-renal syndrome
myotonic dystrophy
  • myotonic dystrophy 1
branchiootic syndrome
  • bo syndrome
potter's syndrome
  • potter sequence
- elite association - COSMIC cancer census association via MalaCards
Search SIX5 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

SIX5_HUMAN
  • Branchiootorenal syndrome 2 (BOR2) [MIM:610896]: A syndrome characterized by branchial cleft fistulas or cysts, sensorineural and/or conductive hearing loss, pre-auricular pits, structural defects of the outer, middle or inner ear, and renal malformations. {ECO:0000269 PubMed:17357085}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for SIX5

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with SIX5: view

No data available for Genatlas for SIX5 Gene

Publications for SIX5 Gene

  1. A novel homeodomain-encoding gene is associated with a large CpG island interrupted by the myotonic dystrophy unstable (CTG)n repeat. (PMID: 8595416) Boucher CA … Chartier FL (Human molecular genetics 1995) 2 3 4 22 58
  2. Transcription factor SIX5 is mutated in patients with branchio-oto-renal syndrome. (PMID: 17357085) Hoskins BE … Hildebrandt F (American journal of human genetics 2007) 3 4 22 58
  3. Six and Eya expression during human somitogenesis and MyoD gene family activation. (PMID: 12500905) Fougerousse F … Maire P (Journal of muscle research and cell motility 2002) 3 4 22 58
  4. Characterization of the expression of DMPK and SIX5 in the human eye and implications for pathogenesis in myotonic dystrophy. (PMID: 9949207) Winchester CL … Johnson KJ (Human molecular genetics 1999) 3 4 22 58
  5. Assessment of a polymorphism of SDK1 with hypertension in Japanese Individuals. (PMID: 19851296) Oguri M … Yamada Y (American journal of hypertension 2010) 3 44 58

Products for SIX5 Gene

Sources for SIX5 Gene

Content
Loading form....