Free for academic non-profit institutions. Other users need a Commercial license
Sialic acid-binding immunoglobulin (Ig)-like lectins, or SIGLECs (e.g., CD33 (MIM 159590)), are a family of type 1 transmembrane proteins each having a unique expression pattern, mostly in hemopoietic cells. SIGLEC8 is a member of the CD33-like subgroup of SIGLECs, which are localized to 19q13.3-q13.4 and have 2 conserved cytoplasmic tyrosine-based motifs: an immunoreceptor tyr... See more...
Aliases for SIGLEC8 Gene
Aliases for SIGLEC8 Gene
External Ids for SIGLEC8 Gene
- HGNC: 10877
- Entrez Gene: 27181
- Ensembl: ENSG00000105366
- OMIM: 605639
- UniProtKB: Q9NYZ4
Previous GeneCards Identifiers for SIGLEC8 Gene
- GC19M052585
- GC19M052315
- GC19M056630
- GC19M056646
- GC19M051955
- GC19M048286
- GC19M051956
Summaries for SIGLEC8 Gene
-
Sialic acid-binding immunoglobulin (Ig)-like lectins, or SIGLECs (e.g., CD33 (MIM 159590)), are a family of type 1 transmembrane proteins each having a unique expression pattern, mostly in hemopoietic cells. SIGLEC8 is a member of the CD33-like subgroup of SIGLECs, which are localized to 19q13.3-q13.4 and have 2 conserved cytoplasmic tyrosine-based motifs: an immunoreceptor tyrosine-based inhibitory motif, or ITIM (see MIM 604964), and a motif homologous to one identified in signaling lymphocyte activation molecule (SLAM; MIM 603492) that mediates an association with SLAM-associated protein (SAP; MIM 300490) (summarized by Foussias et al., 2000 [PubMed 11095983]).[supplied by OMIM, May 2010]
GeneCards Summary for SIGLEC8 Gene
SIGLEC8 (Sialic Acid Binding Ig Like Lectin 8) is a Protein Coding gene. Among its related pathways are Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell and Class I MHC mediated antigen processing and presentation. Gene Ontology (GO) annotations related to this gene include transmembrane signaling receptor activity and carbohydrate binding. An important paralog of this gene is SIGLEC12.
UniProtKB/Swiss-Prot Summary for SIGLEC8 Gene
-
Putative adhesion molecule that mediates sialic-acid dependent binding to red blood cells (PubMed:10856141, PubMed:10625619). Preferentially binds to alpha-2,3-linked sialic acid. Also binds to alpha-2,6-linked sialic acid. The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface (PubMed:10625619). Recognizes simultaneously epitopes having a terminal N-acetylneuraminic acid (sialic acid) and an underlying 6-O-sulfated galactose. Preferentially binds to Gal-6-sulfated sialyl-Lewis X glycan epitopes (PubMed:27357658).
Additional gene information for SIGLEC8 Gene
No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for SIGLEC8 Gene
Genomics for SIGLEC8 Gene
GeneHancer (GH) Regulatory Elements for SIGLEC8 Gene
Promoters and enhancers for SIGLEC8 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication |
Request up-to-date GeneHancer data (full dataset)
GeneHancers around SIGLEC8 on UCSC Golden Path with GeneCards custom track
- Top Transcription factor binding sites by QIAGEN in the SIGLEC8 gene promoter:
-
- AML1a
- AP-1
- ARP-1
- c-Myc
- Max1
- NF-kappaB
- NF-kappaB1
- PPAR-gamma1
- PPAR-gamma2
- RelA
Genomic Locations for SIGLEC8 Gene
Genomic Locations for SIGLEC8 Gene
- chr19:51,450,847-51,458,456
- (GRCh38/hg38)
- Size:
- 7,610 bases
- Orientation:
- Minus strand
- chr19:51,954,101-51,961,710
- (GRCh37/hg19)
- Size:
- 7,610 bases
- Orientation:
- Minus strand
Genomic View for SIGLEC8 Gene
Genes around SIGLEC8 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 19q13.33-q13.41 by HGNC
- 19q13.41 by Entrez Gene
- 19q13.41 by Ensembl
SIGLEC8 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for SIGLEC8 Gene
Proteins for SIGLEC8 Gene
-
Protein details for SIGLEC8 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q9NYZ4-SIGL8_HUMAN
- Recommended name:
- Sialic acid-binding Ig-like lectin 8
- Protein Accession:
- Q9NYZ4
- Q7Z728
Protein attributes for SIGLEC8 Gene
- Size:
- 499 amino acids
- Molecular mass:
- 54042 Da
- Quaternary structure:
- No Data Available
Protein Expression for SIGLEC8 Gene
Post-translational modifications for SIGLEC8 Gene
Other Protein References for SIGLEC8 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
-
Miltenyi Biotec B.V. & Co. KG
- Anti Siglec-8 Antibody (130-098-725)
- Anti Siglec-8 Antibody (130-098-727)
- Anti Siglec-8 Antibody (130-098-715)
- Anti Siglec-8 Antibody (130-098-714)
- Anti Siglec-8 Antibody (130-098-729)
- Anti Siglec-8 Antibody (130-098-716)
- Anti Siglec-8 Antibody (130-098-712)
- Anti Siglec-8 Antibody (130-098-731)
- Anti Siglec-8 Antibody (130-105-576)
- Anti Siglec-8 Antibody (130-105-524)
- Anti Siglec-8 Antibody (130-108-015)
- Recombinant Anti Siglec-8 Antibody (130-117-973)
- Recombinant Anti Siglec-8 Antibody (130-117-900)
- Recombinant Anti Siglec-8 Antibody (130-117-903)
- Recombinant Anti Siglec-8 Antibody (130-117-977)
- Recombinant Anti Siglec-8 Antibody (130-117-901)
- Recombinant Anti Siglec-8 Antibody (130-117-976)
- Recombinant Anti Siglec-8 Antibody (130-117-902)
- Recombinant Anti Siglec-8 Antibody (130-117-975)
- Recombinant Anti Siglec-8 Antibody (130-117-974)
- Recombinant Anti Siglec-8 Antibody (130-117-904)
- Recombinant Anti Siglec-8 Antibody (130-117-980)
- Recombinant Anti Siglec-8 Antibody (130-117-907)
- Recombinant Anti Siglec-8 Antibody (130-124-311)
- G Biosciences Immunotag™ CD329 Polyclonal Antibody
- Atlas Antibodies Anti-SIGLEC8 Antibody
- Creative Diagnostics Anti-SIGLEC8 (aa 1-193) polyclonal antibody and Anti-SIGLEC8 (aa 18-121) polyclonal antibody
-
Creative Biolabs
- Mouse Anti-SIGLEC8 Recombinant Antibody (CBXS-1949)
- Mouse Anti-SIGLEC8 Recombinant Antibody (CBXS-0373)
- Recombinant Mouse anti-Human SIGLEC8 Monoclonal antibody (EML1447)
- Mouse Anti-SIGLEC8 Recombinant Antibody (CBXS-3127)
- Anti-Human Siglec-8 Therapeutic Antibody Fab Fragment (hu2E2)
- Anti-Human Siglec-8 Therapeutic Antibody (hu2E2)
-
BioLegend
- Siglec-8 Antibody (347103)
- Siglec-8 Antibody (347104)
- Siglec-8 Antibody (347102)
- Siglec-8 Antibody (347106)
- Siglec-8 Antibody (347105)
- Siglec-8 Antibody (347112)
- Siglec-8 Antibody (347110)
- Siglec-8 Antibody (347109)
- Siglec-8 Antibody (347111)
- PerCP/Cyanine5.5 Siglec-8 Antibody (347107)
- PerCP/Cyanine5.5 Siglec-8 Antibody (347108)
-
Custom Antibody ServicesOriGene Antibodies for SIGLEC8
- Novus Biologicals Antibodies for SIGLEC8
-
Abcam antibodies for SIGLEC8
- Invitrogen Antibodies for SIGLEC8 (AFLGC-SIGLEC8)
Protein Products
-
OriGene Purified Proteins for SIGLEC8
- Search Origene for MassSpec and Protein Over-expression Lysates for SIGLEC8
- Origene Custom Protein Services for SIGLEC8
- antibodies-online: Show 7 available SIGLEC8 Proteins ranked by validation data
- Compare Top SIGLEC8 Proteins
-
Quality Products:
-
Abcam proteins for SIGLEC8
Assay Products
- Aviva Systems Biology SIGLEC8 ELISA Kit (Human) (OKDD00528) and SIGLEC8 ELISA Kit (Human) (OKCD07660)
- antibodies-online: Show 20 available SIGLEC8 Elisa Kits ranked by validation data
- Compare Top SIGLEC8 Elisa Kits
-
Quality Products:
No data available for DME Specific Peptides for SIGLEC8 Gene
Domains & Families for SIGLEC8 Gene
Gene Families for SIGLEC8 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- CD markers
- Plasma proteins
- Predicted membrane proteins
Protein Domains for SIGLEC8 Gene
- Blocks:
- InterPro:
- ProtoNet:
Suggested Antigen Peptide Sequences for SIGLEC8 Gene
- GenScript: Design optimal peptide antigens:
-
- Sialoadhesin family member 2 (SIGL8_HUMAN)
Graphical View of Domain Structure for InterPro Entry
Q9NYZ4UniProtKB/Swiss-Prot:
SIGL8_HUMAN :- Contains 1 copy of a cytoplasmic motif that is referred to as the immunoreceptor tyrosine-based inhibitor motif (ITIM). This motif is involved in modulation of cellular responses. The phosphorylated ITIM motif can bind the SH2 domain of several SH2-containing phosphatases.
- Belongs to the immunoglobulin superfamily. SIGLEC (sialic acid binding Ig-like lectin) family.
- Domain:
-
- Contains 1 copy of a cytoplasmic motif that is referred to as the immunoreceptor tyrosine-based inhibitor motif (ITIM). This motif is involved in modulation of cellular responses. The phosphorylated ITIM motif can bind the SH2 domain of several SH2-containing phosphatases.
- Family:
-
- Belongs to the immunoglobulin superfamily. SIGLEC (sialic acid binding Ig-like lectin) family.
Function for SIGLEC8 Gene
Molecular function for SIGLEC8 Gene
- UniProtKB/Swiss-Prot Function:
- Putative adhesion molecule that mediates sialic-acid dependent binding to red blood cells (PubMed:10856141, PubMed:10625619). Preferentially binds to alpha-2,3-linked sialic acid. Also binds to alpha-2,6-linked sialic acid. The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface (PubMed:10625619). Recognizes simultaneously epitopes having a terminal N-acetylneuraminic acid (sialic acid) and an underlying 6-O-sulfated galactose. Preferentially binds to Gal-6-sulfated sialyl-Lewis X glycan epitopes (PubMed:27357658).
- GENATLAS Biochemistry:
- sialic acid binding Ig-like lectin 8,specifically expressed by eosinophils,sialoadhesin family,Ig superfamily
Phenotypes From GWAS Catalog for SIGLEC8 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0004888 | transmembrane signaling receptor activity | TAS | 10625619 |
| GO:0005515 | protein binding | IPI | 21982860 |
| GO:0030246 | carbohydrate binding | IEA,TAS | -- |
Phenotypes for SIGLEC8 Gene
- MGI mutant phenotypes for SIGLEC8:
- inferred from 2 alleles
- GenomeRNAi human phenotypes for SIGLEC8:
-
- Strongly decreased NFAT1-GFP nuclear translocation
- Increased homologous recombination repair frequency
- Decreased viability
- no effect
- Increased vaccinia virus (VACV) infection
- Resistant to vaccinia virus (VACV-A4L) infection
- Increased gamma-H2AX phosphorylation
- Decreased NF-kappaB reporter expression
- Decreased IL-8 secretion
- Increased viability
Animal Models for SIGLEC8 Gene
- MGI Knock Outs for SIGLEC8:
-
- Siglecf Siglecf<tm1.2Avrk>
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
CRISPR Products
-
OriGene CRISPR knockouts for SIGLEC8
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for SIGLEC8
- genomics-online: gRNA clones - Search for available SIGLEC8 gRNA products
- Overview of 34 available SIGLEC8 gene related products
- Applied Biological Materials (abm): CRISPR Clones for SIGLEC8 - Select products 50% OFF >
- * SIGLEC8 CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * SIGLEC8 CRISPR applications: KO, Activation, Repression, and more - Browse All
-
Santa Cruz Biotechnology (SCBT) CRISPR for SIGLEC8
miRNA for SIGLEC8 Gene
- miRTarBase miRNAs that target SIGLEC8
-
- hsa-mir-335-5p (MIRT017964)
- hsa-mir-500a-3p (MIRT723507)
- hsa-mir-6864-3p (MIRT723508)
- hsa-mir-3672 (MIRT723509)
- hsa-mir-1200 (MIRT723510)
- hsa-mir-378a-5p (MIRT723511)
- hsa-mir-4326 (MIRT723512)
- hsa-mir-431-5p (MIRT723513)
- hsa-mir-6804-3p (MIRT723514)
- hsa-mir-873-3p (MIRT723515)
- hsa-mir-4329 (MIRT723516)
- hsa-mir-5699-3p (MIRT723517)
- hsa-mir-4421 (MIRT723518)
- hsa-mir-544b (MIRT723519)
- hsa-mir-4324 (MIRT723520)
- hsa-mir-215-5p (MIRT733868)
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for SIGLEC8
- Browse OriGene Inhibitory RNA Products For SIGLEC8
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for SIGLEC8
- genomics-online: shRNA clones - Search for available SIGLEC8 shRNA products
- Overview of 34 available SIGLEC8 gene related products
Clone Products
- Sino Biological Human cDNA Clone for SIGLEC8
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for SIGLEC8
- Applied Biological Materials (abm): Clones for SIGLEC8 - Select products 50% OFF >
- * SIGLEC8 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * SIGLEC8 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
Cell Line Products
-
Horizon Cell Lines for SIGLEC8
No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for SIGLEC8 Gene
Localization for SIGLEC8 Gene
Subcellular locations from UniProtKB/Swiss-Prot for SIGLEC8 Gene
- Membrane; Single-pass type I membrane protein.
| Compartment | Confidence |
|---|---|
| plasma membrane | 3 |
| extracellular | 3 |
| cytosol | 2 |
| mitochondrion | 1 |
| endoplasmic reticulum | 0 |
| lysosome | 0 |
- Cytosol (1)
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0016020 | membrane | IEA | -- |
| GO:0016021 | integral component of membrane | TAS,IEA | -- |
Pathways & Interactions for SIGLEC8 Gene
Pathways by source for SIGLEC8 Gene
3 Reactome pathways for SIGLEC8 Gene
1 R&D Systems pathway for SIGLEC8 Gene
Interacting Proteins for SIGLEC8 Gene
Selected Interacting proteins:
Q9NYZ4-SIGL8_HUMAN
ENSP00000321077
for SIGLEC8 Gene via
UniProtKB
STRING
IID
GPS-Prot Interaction Network for SIGLEC8
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0007155 | cell adhesion | IEA | -- |
| GO:0007165 | signal transduction | TAS | 10625619 |
No data available for SIGNOR curated interactions for SIGLEC8 Gene
Transcripts for SIGLEC8 Gene
mRNA/cDNA for SIGLEC8 Gene
- (2) REFSEQ mRNAs :
- (9) Additional mRNA sequences :
- (11) Selected AceView cDNA sequences:
- (4) Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
-
- ENST00000321424 2949 bps (ENST00000321424.7)
- ENST00000340550 1293 bps (ENST00000340550.5)
- ENST00000430817 1528 bps (ENST00000430817.5)
- ENST00000597352 589 bps (ENST00000597352.1)
CRISPR Products
-
OriGene CRISPR knockouts for SIGLEC8
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for SIGLEC8
- genomics-online: gRNA clones - Search for available SIGLEC8 gRNA products
- Overview of 34 available SIGLEC8 gene related products
- Applied Biological Materials (abm): CRISPR Clones for SIGLEC8 - Select products 50% OFF >
- * SIGLEC8 CRISPR as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Protein Vector - Browse All
- * SIGLEC8 CRISPR applications: KO, Activation, Repression, and more - Browse All
-
Santa Cruz Biotechnology (SCBT) CRISPR for SIGLEC8
miRNA Products
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for SIGLEC8
- Browse OriGene Inhibitory RNA Products For SIGLEC8
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for SIGLEC8
- genomics-online: shRNA clones - Search for available SIGLEC8 shRNA products
- Overview of 34 available SIGLEC8 gene related products
Clone Products
- Sino Biological Human cDNA Clone for SIGLEC8
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for SIGLEC8
- Applied Biological Materials (abm): Clones for SIGLEC8 - Select products 50% OFF >
- * SIGLEC8 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
- * SIGLEC8 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All
Expression for SIGLEC8 Gene
mRNA differential expression in normal tissues according to GTEx for SIGLEC8 Gene
This gene is overexpressed in Brain - Spinal cord (cervical c-1) (x7.9), Spleen (x5.5), and Brain - Substantia nigra (x5.1).
This gene is overexpressed in Heart (52.0) and Adipocyte (17.0).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for SIGLEC8 Gene
NURSA nuclear receptor signaling pathways regulating expression of SIGLEC8 Gene:
SIGLEC8SOURCE GeneReport for Unigene cluster for SIGLEC8 Gene:
Hs.447899mRNA Expression by UniProt/SwissProt for SIGLEC8 Gene:
Q9NYZ4-SIGL8_HUMAN
Tissue specificity:
Expressed specifically on red blood cells namely basophil, mast cells and eosinophils.
Evidence on tissue expression from TISSUES for SIGLEC8 Gene
- Spleen(4.4)
- Blood(4.3)
Primer Products
-
OriGene qPCR primer pairs for SIGLEC8
- genomics-online: primer clones - Search for available SIGLEC8 Primer products
- Overview of 34 available SIGLEC8 gene related products
Gene Expression Assay Products
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and Phenotype-based relationships between genes and organs from Gene ORGANizer for SIGLEC8 Gene
Orthologs for SIGLEC8 Gene
This gene was present in the common ancestor of mammals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | SIGLEC8 33 |
|
OneToOne | |
| dog (Canis familiaris) |
Mammalia | SIGLEC12 32 |
|
||
| -- 33 |
|
OneToMany | |||
| cow (Bos Taurus) |
Mammalia | -- 33 |
|
OneToMany | |
| LOC618463 32 |
|
||||
| rat (Rattus norvegicus) |
Mammalia | Siglec5 32 |
|
||
| mouse (Mus musculus) |
Mammalia | Siglec5 32 |
|
||
| Siglece 33 |
|
OneToMany | |||
| Siglecf 17 |
|
- Species where no ortholog for SIGLEC8 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- chicken (Gallus gallus)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- fruit fly (Drosophila melanogaster)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- lizard (Anolis carolinensis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- oppossum (Monodelphis domestica)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- platypus (Ornithorhynchus anatinus)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- tropical clawed frog (Silurana tropicalis)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
- zebrafish (Danio rerio)
Evolution for SIGLEC8 Gene
- ENSEMBL:
- Gene Tree for SIGLEC8 (if available)
- TreeFam:
- Gene Tree for SIGLEC8 (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for SIGLEC8: view image
Paralogs for SIGLEC8 Gene
Paralogs for SIGLEC8 Gene
(9) SIMAP similar genes for SIGLEC8 Gene using alignment to 2 proteins:
- SIGL8_HUMAN
- C9JT30_HUMAN
Pseudogenes.org Pseudogenes for SIGLEC8 Gene
Variants for SIGLEC8 Gene
| SNP ID | Clin | Chr 19 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| rs1000008400 | -- | 51,460,065(-) | T/G | upstream_transcript_variant | |
| rs1000195859 | -- | 51,452,521(-) | T/C | coding_sequence_variant, missense_variant | |
| rs1000496456 | -- | 51,456,699(-) | G/A/C | intron_variant | |
| rs1000607577 | -- | 51,459,521(-) | ATGATGATGATGATGATTAT/AT | upstream_transcript_variant | |
| rs1001137131 | -- | 51,451,105(-) | T/C | 3_prime_UTR_variant |
Residual Variation Intolerance Score:
92.2% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
9.51;
88.82% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for SIGLEC8 Gene
- SNPedia medical, phenotypic, and genealogical associations of SNPs for
- SIGLEC8
SNP Genotyping and Copy Number Assay Products
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SIGLEC8 Gene
Disorders for SIGLEC8 Gene
Additional Disease Information for SIGLEC8
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No disorders were found for SIGLEC8 Gene.
No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SIGLEC8 Gene
Publications for SIGLEC8 Gene
- Polymorphisms in the sialic acid-binding immunoglobulin-like lectin-8 (Siglec-8) gene are associated with susceptibility to asthma. (PMID: 20087405) Gao PS … Bochner BS (European journal of human genetics : EJHG 2010) 3 23 43 56
- Siglec-8. A novel eosinophil-specific member of the immunoglobulin superfamily. (PMID: 10625619) Floyd H … Crocker PR (The Journal of biological chemistry 2000) 2 3 4 56
- Molecular characterization of a Siglec8 variant containing cytoplasmic tyrosine-based motifs, and mapping of the Siglec8 gene. (PMID: 11095983) Foussias G … Diamandis EP (Biochemical and biophysical research communications 2000) 3 4 23 56
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 56
- Identification of SAF-2, a novel siglec expressed on eosinophils, mast cells, and basophils. (PMID: 10856141) Kikly KK … White JR (The Journal of allergy and clinical immunology 2000) 3 4 56
ExternalLinks
Products for SIGLEC8 Gene
- View all 13 R&D Systems SIGLEC8 (Siglec-8) Products
- View all R&D Systems SIGLEC8 (Siglec-8) Proteins and Enzymes
- View all 11 R&D Systems SIGLEC8 (Siglec-8) Primary Antibodies
- View all R&D Systems SIGLEC8 (Siglec-8) cDNA Clones
- Learn more about R&D Systems custom SIGLEC8 antibody, protein, and immunoassay development services
- Custom Antibody ServicesOriGene Antibodies for SIGLEC8
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for SIGLEC8
- Search Origene for MassSpec and Protein Over-expression Lysates for SIGLEC8
- Origene Custom Protein Services for SIGLEC8
- Origene sirna, shrna, and RNAi products in human, mouse, rat for SIGLEC8
- Browse OriGene Inhibitory RNA Products For SIGLEC8
- OriGene qPCR primer pairs for SIGLEC8
- OriGene CRISPR knockouts for SIGLEC8
- OriGene ORF clones in human for SIGLEC8
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For SIGLEC8
- Sino Biological Human cDNA Clone for SIGLEC8
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse cDNA Clones
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Novus Biologicals Antibodies for SIGLEC8
- Novus Biologicals proteins and lysates for SIGLEC8
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for SIGLEC8
- Abcam proteins for SIGLEC8
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Invitrogen Antibodies for SIGLEC8 (AFLGC-SIGLEC8)
- antibodies-online: Show 13 available SIGLEC8 Antibodies ranked by validation data
- Compare Top SIGLEC8 Antibodies
- antibodies-online: Show 20 available SIGLEC8 Elisa Kits ranked by validation data
- Compare Top SIGLEC8 Elisa Kits
- Quality Products:
- antibodies-online: Show 7 available SIGLEC8 Proteins ranked by validation data
- Compare Top SIGLEC8 Proteins
- Quality Products:
- Horizon Cell Lines for SIGLEC8
- genomics-online: cdna clones - Search for available SIGLEC8 CDNA products
- Overview of 34 available SIGLEC8 gene related products
- orf clones - Search for available SIGLEC8 ORF products
- Overview of 34 available SIGLEC8 gene related products
- genomics-online: gRNA clones - Search for available SIGLEC8 gRNA products
- Overview of 34 available SIGLEC8 gene related products
- genomics-online: primer clones - Search for available SIGLEC8 Primer products
- Overview of 34 available SIGLEC8 gene related products
- genomics-online: shRNA clones - Search for available SIGLEC8 shRNA products
- Overview of 34 available SIGLEC8 gene related products
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for SIGLEC8
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for SIGLEC8
- Search GeneCopoeia for miRNA 3'UTR Target clone products for SIGLEC8
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for SIGLEC8
Sources for SIGLEC8 Gene
- (1) GeneCards
- (2) HGNC
- (3) NCBI Entrez Gene
- (4) UniProtKB/Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) Cell Signaling Technology
- (12) GO
- (13) UniProtKB/TrEMBL
- (14) InterPro
- (15) ProtoNet
- (16) Blocks
- (17) MGI
- (18) IUBMB
- (19) KEGG
- (20) MINT
- (21) STRING
- (22) IntAct
- (23) Novoseek
- (24) PharmGKB
- (25) DrugBank
- (26) HMDB
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) CGAP SAGE
- (31) SOURCE
- (32) HomoloGene
- (33) PanEnsembl
- (34) euGenes
- (35) SGD
- (36) FlyBase
- (37) WormBase
- (38) Pseudogene
- (39) DGV
- (40) dbSNP
- (41) GenAtlas
- (42) HGMD
- (43) GAD
- (44) BGMUT
- (45) HuGE
- (46) Atlas
- (47) GenBank
- (48) H-invDB
- (49) HORDE
- (50) HUGE
- (51) IMGT
- (52) Leiden
- (53) miRBase
- (54) DME
- (55) OriGene
- (56) PubMed
- (57) R&D Systems
- (58) TGDB
- (59) Tocris
- (60) Abcam
- (61) Novus Biologicals
- (62) ProSpec
- (63) Sino Biological
- (64) GenScript
- (65) Qiagen
- (66) OCA
- (67) Proteopedia
- (68) MOPED
- (69) neXtProt
- (70) Reactome
- (71) GeneGo (Thomson Reuters)
- (72) DISEASES
- (73) SIMAP
- (74) GenomeRNAi
- (75) LifeMap
- (76) miRTarBase
- (77) MalaCards
- (78) Invitrogen
- (79) BitterDB
- (80) ESI-BIO
- (81) RefSeq
- (82) BioSystems
- (83) MaxQB
- (84) IUPHAR
- (85) BioGPS
- (86) Illumina
- (87) COMPARTMENTS
- (88) HOMER
- (89) PaxDb
- (90) ApexBio
- (91) Addgene
- (92) antibodies-online
- (93) CYP
- (94) NONCODE
- (95) TreeFam
- (96) PathCards
- (97) GeneReviews
- (98) GeneTex
- (99) Taconic Biosciences
- (100) GTEx
- (101) ProteomicsDB
- (102) SCBT
- (103) DGIdb
- (104) ClinicalTrials
- (105) RVIS
- (106) SIGNOR
- (107) diseasecard
- (108) NIH Rare Diseases
- (109) Orphanet
- (110) UMLS
- (111) GTR
- (112) Disease Ontology
- (113) Genetics Home Reference
- (114) MeSH
- (115) MedlinePlus
- (116) CDC
- (117) NINDS
- (118) NCBI Bookshelf
- (119) ClinVar
- (120) Gene Damage Index
- (121) HPO
- (122) UDN
- (123) VISTA
- (124) FANTOM5
- (125) ENCODE
- (126) ProSci
- (127) Horizon
- (128) NURSA
- (129) IID
- (130) VectorBuilder
- (131) SNPedia
- (132) BRCA Exchange
- (133) CIViC
- (134) ProteoGenix
- (135) dbSUPER
- (136) TISSUES
- (137) Gene ORGANizer
- (138) abm
- (139) Human Protein Atlas
- (140) GWAS Catalog
- (141) Monarch Initiative
- (142) DataMed
- (143) HumanCyc
- (144) genomics-online
- (145) UCNEbase
- (146) EPDnew
- (147) Applied Biosystems
- (148) GlyConnect
- (149) Aminode
- (150) GeneCopoeia
- (151) GPS-Prot
- (152) RNACentral
- (153) LncRNADisease
- (154) LOVD
- (155) miR2Disease
- (156) DiseaseEnhancer
- (157) Boster Bio
- (158) Biorbyt
- (159) Biocompare
- (160) Mastermind
- (161) CTD^2 Dashboard
- (162) CraniofacialAtlas
- (163) GeneImprint
- (164) Synthego
- (165) Bio Basic
- (166) ENA
- (167) GtRNAdb
- (168) LncBase
- (169) LncBook
- (170) LNCipedia
- (171) LncRNAdb
- (172) Modomics
- (173) PDBe
- (174) Rfam
- (175) SILVA
- (176) snOPY
- (177) SRPDB
- (178) GENCODE
- (179) TarBase
- (180) MyBioSource