Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SIGLEC16 Gene

Aliases for SIGLEC16 Gene

  • Sialic Acid Binding Ig Like Lectin 16 (Gene/Pseudogene) 2 3 5
  • Sialic Acid Binding Ig-Like Lectin, Pseudogene 16 2 3
  • Siglec-P16 3 4
  • Siglec-16 3 4
  • SIGLECP16 3 4
  • Sialic Acid Binding Ig-Like Lectin 16 (Gene/Pseudogene) 2
  • Sialic Acid-Binding Immunoglobulin-Like Lectin 16 3
  • Sialic Acid Binding Ig-Like Lectin 16 3
  • Sialic Acid-Binding Ig-Like Lectin 16 3

External Ids for SIGLEC16 Gene

Previous HGNC Symbols for SIGLEC16 Gene

  • SIGLECP16

Previous GeneCards Identifiers for SIGLEC16 Gene

  • GC19P055168
  • GC19P050473
  • GC19P046849

Summaries for SIGLEC16 Gene

GeneCards Summary for SIGLEC16 Gene

SIGLEC16 (Sialic Acid Binding Ig Like Lectin 16 (Gene/Pseudogene)) is a Protein Coding gene. Among its related pathways are Innate Immune System and RET signaling. Gene Ontology (GO) annotations related to this gene include carbohydrate binding.

UniProtKB/Swiss-Prot for SIGLEC16 Gene

  • Putative adhesion molecule that mediates sialic-acid dependent binding to cells.

Additional gene information for SIGLEC16 Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SIGLEC16 Gene

Genomics for SIGLEC16 Gene

GeneHancer (GH) Regulatory Elements for SIGLEC16 Gene

Promoters and enhancers for SIGLEC16 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH19I049969 Enhancer 0.3 Ensembl 580.5 +0.2 246 1.8 PRDM10 SIGLEC16 ZNF473 ENSG00000276729
GH19I049971 Enhancer 0.2 Ensembl 577.9 +1.9 1946 0.8 SIGLEC16 SIGLEC11 ENSG00000276729
GH19I050022 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 41.9 +55.2 55166 4.5 MLX ZFP64 DMAP1 YY1 SLC30A9 ZNF213 E2F8 ZNF143 ZNF548 SP3 ZNF473 VRK3 POLD1 PTOV1-AS2 SNORD35A NUP62 SNORD35B ALDH16A1 PNKP IRF3
GH19I049983 Enhancer 0.7 ENCODE 31.9 +14.2 14164 0.2 HDGF CTCF FOXA2 SAP130 RB1 TEAD4 ARID4B IRF4 RAD21 CC2D1A SIGLEC16 ENSG00000221125 NUP62 IL4I1 ATF5 ENSG00000276729 VRK3
GH19I049980 Enhancer 0.7 ENCODE 29.7 +12.6 12561 2.6 HDAC1 CTCF TEAD4 TAL1 ZNF266 ZMYM3 FOSL1 TCF12 GATA2 NCOR1 SIGLEC16 NUP62 VRK3 POLD1 PTOV1-AS2 SNORD35A IRF3 SNORD35B SIGLEC11 ALDH16A1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SIGLEC16 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SIGLEC16 gene promoter:

Genomic Locations for SIGLEC16 Gene

Genomic Locations for SIGLEC16 Gene
chr19:49,969,655-49,975,819
(GRCh38/hg38)
Size:
6,165 bases
Orientation:
Plus strand
chr19:50,472,857-50,479,076
(GRCh37/hg19)

Genomic View for SIGLEC16 Gene

Genes around SIGLEC16 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SIGLEC16 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SIGLEC16 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SIGLEC16 Gene

Proteins for SIGLEC16 Gene

  • Protein details for SIGLEC16 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    A6NMB1-SIG16_HUMAN
    Recommended name:
    Sialic acid-binding Ig-like lectin 16
    Protein Accession:
    A6NMB1

    Protein attributes for SIGLEC16 Gene

    Size:
    481 amino acids
    Molecular mass:
    52992 Da
    Quaternary structure:
    No Data Available

neXtProt entry for SIGLEC16 Gene

Post-translational modifications for SIGLEC16 Gene

  • Glycosylation at isoforms=43, posLast=7878, posLast=338338, and posLast=347347

Other Protein References for SIGLEC16 Gene

REFSEQ proteins:

No data available for DME Specific Peptides for SIGLEC16 Gene

Domains & Families for SIGLEC16 Gene

Suggested Antigen Peptide Sequences for SIGLEC16 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

A6NMB1

UniProtKB/Swiss-Prot:

SIG16_HUMAN :
  • Belongs to the immunoglobulin superfamily. SIGLEC (sialic acid binding Ig-like lectin) family.
Family:
  • Belongs to the immunoglobulin superfamily. SIGLEC (sialic acid binding Ig-like lectin) family.
genes like me logo Genes that share domains with SIGLEC16: view

Function for SIGLEC16 Gene

Molecular function for SIGLEC16 Gene

UniProtKB/Swiss-Prot Function:
Putative adhesion molecule that mediates sialic-acid dependent binding to cells.

Gene Ontology (GO) - Molecular Function for SIGLEC16 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0030246 carbohydrate binding IEA --
genes like me logo Genes that share ontologies with SIGLEC16: view

Animal Model Products

miRNA for SIGLEC16 Gene

miRTarBase miRNAs that target SIGLEC16

Clone Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Phenotypes , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for SIGLEC16 Gene

Localization for SIGLEC16 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SIGLEC16 Gene

Membrane; Single-pass type I membrane protein.

Gene Ontology (GO) - Cellular Components for SIGLEC16 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005886 plasma membrane TAS --
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with SIGLEC16: view

No data available for Subcellular locations from COMPARTMENTS and Subcellular locations from the Human Protein Atlas (HPA) for SIGLEC16 Gene

Pathways & Interactions for SIGLEC16 Gene

genes like me logo Genes that share pathways with SIGLEC16: view

Pathways by source for SIGLEC16 Gene

3 Reactome pathways for SIGLEC16 Gene

Interacting Proteins for SIGLEC16 Gene

Selected Interacting proteins: A6NMB1-SIG16_HUMAN for SIGLEC16 Gene via IID

Symbol External ID(s) Details
TYROBP

Gene Ontology (GO) - Biological Process for SIGLEC16 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007155 cell adhesion IEA --
GO:0045087 innate immune response TAS --
genes like me logo Genes that share ontologies with SIGLEC16: view

No data available for SIGNOR curated interactions for SIGLEC16 Gene

Drugs & Compounds for SIGLEC16 Gene

No Compound Related Data Available

Transcripts for SIGLEC16 Gene

mRNA/cDNA for SIGLEC16 Gene

(1) REFSEQ mRNAs :
(3) Selected AceView cDNA sequences:
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for SIGLEC16 Gene

No ASD Table

Relevant External Links for SIGLEC16 Gene

GeneLoc Exon Structure for
SIGLEC16
ECgene alternative splicing isoforms for
SIGLEC16

Expression for SIGLEC16 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SIGLEC16 Gene

mRNA differential expression in normal tissues according to GTEx for SIGLEC16 Gene

This gene is overexpressed in Ovary (x20.4), Spleen (x8.2), and Whole Blood (x4.6).

Protein differential expression in normal tissues from HIPED for SIGLEC16 Gene

This gene is overexpressed in Synovial fluid (12.5), Placenta (12.4), Platelet (7.6), and Monocytes (6.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for SIGLEC16 Gene



NURSA nuclear receptor signaling pathways regulating expression of SIGLEC16 Gene:

SIGLEC16

SOURCE GeneReport for Unigene cluster for SIGLEC16 Gene:

Hs.568076

mRNA Expression by UniProt/SwissProt for SIGLEC16 Gene:

A6NMB1-SIG16_HUMAN
Tissue specificity: Expressed in bone marrow, fetal brain, fetal liver, lung and salivary gland. Detected in brain, macrophage, cancerous esophagus and lung at protein level.
genes like me logo Genes that share expression patterns with SIGLEC16: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein tissue co-expression partners , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for SIGLEC16 Gene

Orthologs for SIGLEC16 Gene

Evolution for SIGLEC16 Gene

ENSEMBL:
Gene Tree for SIGLEC16 (if available)
TreeFam:
Gene Tree for SIGLEC16 (if available)

No data available for Orthologs for SIGLEC16 Gene

Paralogs for SIGLEC16 Gene

(10) SIMAP similar genes for SIGLEC16 Gene using alignment to 2 proteins:

genes like me logo Genes that share paralogs with SIGLEC16: view

No data available for Paralogs for SIGLEC16 Gene

Variants for SIGLEC16 Gene

Sequence variations from dbSNP and Humsavar for SIGLEC16 Gene

SNP ID Clin Chr 19 pos Variation AA Info Type
rs1000389417 -- 49,969,357(+) GAATGAATGAATGAATGAATG/GAATGAATGAATGAATG/GAATGAATGAATGAATGAATGAATG/GAATGAATGAATGAATGAATGAATGAATG upstream_transcript_variant
rs1000678030 -- 49,969,409(+) A/G upstream_transcript_variant
rs1001183932 -- 49,972,519(+) C/T intron_variant
rs1001380899 -- 49,968,396(+) GTTG/GTTGTTG upstream_transcript_variant
rs1002590397 -- 49,968,981(+) A/G upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for SIGLEC16 Gene

Variant ID Type Subtype PubMed ID
dgv54n68 CNV loss 17160897
esv3644630 CNV gain 21293372
esv3644635 CNV gain 21293372
nsv1065648 CNV gain 25217958
nsv1065753 CNV gain 25217958
nsv1140251 OTHER inversion 24896259
nsv579912 CNV gain 21841781
nsv7309 OTHER inversion 18451855
nsv9739 CNV gain+loss 18304495

Additional Variant Information for SIGLEC16 Gene

Human Gene Mutation Database (HGMD)
SIGLEC16
SNPedia medical, phenotypic, and genealogical associations of SNPs for
SIGLEC16

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for SIGLEC16 Gene

Disorders for SIGLEC16 Gene

Additional Disease Information for SIGLEC16

No disorders were found for SIGLEC16 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SIGLEC16 Gene

Publications for SIGLEC16 Gene

  1. SIGLEC16 encodes a DAP12-associated receptor expressed in macrophages that evolved from its inhibitory counterpart SIGLEC11 and has functional and non-functional alleles in humans. (PMID: 18629938) Cao H … Barrow AD (European journal of immunology 2008) 2 3 4 58
  2. Cloning and characterization of human Siglec-11. A recently evolved signaling molecule that can interact with SHP-1 and SHP-2 and is expressed by tissue macrophages, including brain microglia. (PMID: 11986327) Angata T … Varki A (The Journal of biological chemistry 2002) 2 3 4 58
  3. The DNA sequence and biology of human chromosome 19. (PMID: 15057824) Grimwood J … Lucas SM (Nature 2004) 3 4 58
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
  5. Paired Siglec receptors generate opposite inflammatory responses to a human-specific pathogen. (PMID: 28100677) Schwarz F … Varki A (The EMBO journal 2017) 3 58

Products for SIGLEC16 Gene

Sources for SIGLEC16 Gene

Content
Loading form....