Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SH3BP5 Gene

Aliases for SH3BP5 Gene

  • SH3 Domain Binding Protein 5 2 3 5
  • SH3 Domain-Binding Protein That Preferentially Associates With BTK 3 4
  • SH3-Domain Binding Protein 5 (BTK-Associated) 2 3
  • SH3BP-5 3 4
  • SAB 3 4
  • SH3 Domain-Binding Protein 5 3
  • SH3 Binding Protein 2

External Ids for SH3BP5 Gene

Previous GeneCards Identifiers for SH3BP5 Gene

  • GC03M015225
  • GC03M015271
  • GC03M015296

Summaries for SH3BP5 Gene

GeneCards Summary for SH3BP5 Gene

SH3BP5 (SH3 Domain Binding Protein 5) is a Protein Coding gene. Diseases associated with SH3BP5 include Endocardium Disease and Tabes Dorsalis. Among its related pathways are B cell receptor signaling pathway (KEGG). Gene Ontology (GO) annotations related to this gene include SH3 domain binding and protein kinase inhibitor activity. An important paralog of this gene is SH3BP5L.

UniProtKB/Swiss-Prot for SH3BP5 Gene

  • Inhibits the auto- and transphosphorylation activity of BTK. Plays a negative regulatory role in BTK-related cytoplasmic signaling in B-cells. May be involved in BCR-induced apoptotic cell death.

Gene Wiki entry for SH3BP5 Gene

Additional gene information for SH3BP5 Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SH3BP5 Gene

Genomics for SH3BP5 Gene

GeneHancer (GH) Regulatory Elements for SH3BP5 Gene

Promoters and enhancers for SH3BP5 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH03I015323 Promoter/Enhancer 2.5 EPDnew Ensembl ENCODE dbSUPER 564.9 +12.6 12638 11.1 HDGF PKNOX1 CLOCK FOXA2 SIN3A FEZF1 ZBTB7B IRF4 YY1 ZNF143 SH3BP5 RBSN SH3BP5-AS1 CCDC174 METTL6 NR2C2 ENSG00000270409 CAPN7 HACL1 RPS3AP53
GH03I015267 Promoter/Enhancer 1.9 EPDnew Ensembl ENCODE dbSUPER 561.7 +70.3 70341 6.3 HDGF HNRNPUL1 PKNOX1 ARNT SIN3A IRF4 POLR2B CBX5 ZNF207 ZNF143 SH3BP5 CCDC174 SH3BP5-AS1 CAPN7 NR2C2 RNU6-454P COL6A4P1 RNU6-1024P RBSN FGD5-AS1
GH03I015339 Enhancer 1 Ensembl ENCODE 550.8 +1.3 1306 0.2 HDAC1 HDGF ATF1 ARNT TCF12 FOS ETV6 ATF7 ZBTB2 NCOA1 SH3BP5 RNU6-454P GC03P015339
GH03I015341 Promoter 0.5 EPDnew 550.8 0.0 -6 0.1 GC03P015339 RNU6-454P SH3BP5 GC03M015375
GH03I015342 Enhancer 0.5 ENCODE dbSUPER 550.8 -0.6 -642 0 ZNF121 SH3BP5 GC03M015375
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SH3BP5 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SH3BP5 gene promoter:

Genomic Locations for SH3BP5 Gene

Genomic Locations for SH3BP5 Gene
87,042 bases
Minus strand

Genomic View for SH3BP5 Gene

Genes around SH3BP5 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SH3BP5 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SH3BP5 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SH3BP5 Gene

Proteins for SH3BP5 Gene

  • Protein details for SH3BP5 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    SH3 domain-binding protein 5
    Protein Accession:
    Secondary Accessions:
    • B3KQW6
    • Q5JWV9

    Protein attributes for SH3BP5 Gene

    455 amino acids
    Molecular mass:
    50425 Da
    Quaternary structure:
    • Interacts with BTK (PubMed:9571151, PubMed:10339589). Interacts with all isoforms of MAPK8, MAPK9, MAPK10 and MAPK12 (PubMed:12167088). Interacts with GDP-bound and nucleotide-free forms of RAB11A (PubMed:26506309).
    • Sequence=BAA25922.1; Type=Erroneous initiation; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for SH3BP5 Gene

    Alternative splice isoforms for SH3BP5 Gene


neXtProt entry for SH3BP5 Gene

Post-translational modifications for SH3BP5 Gene

  • Ubiquitination at posLast=173173, posLast=215215, and isoforms=2248

No data available for DME Specific Peptides for SH3BP5 Gene

Domains & Families for SH3BP5 Gene

Gene Families for SH3BP5 Gene

Human Protein Atlas (HPA):
  • Plasma proteins
  • Predicted intracellular proteins

Protein Domains for SH3BP5 Gene


Graphical View of Domain Structure for InterPro Entry



  • Belongs to the SH3BP5 family.
  • Belongs to the SH3BP5 family.
genes like me logo Genes that share domains with SH3BP5: view

Function for SH3BP5 Gene

Molecular function for SH3BP5 Gene

GENATLAS Biochemistry:
SH3-domain binding protein 5,BTK-associated transregulator
UniProtKB/Swiss-Prot Function:
Inhibits the auto- and transphosphorylation activity of BTK. Plays a negative regulatory role in BTK-related cytoplasmic signaling in B-cells. May be involved in BCR-induced apoptotic cell death.

Phenotypes From GWAS Catalog for SH3BP5 Gene

Gene Ontology (GO) - Molecular Function for SH3BP5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004860 protein kinase inhibitor activity IDA 10339589
GO:0005515 protein binding IPI 9571151
GO:0017124 SH3 domain binding IBA --
genes like me logo Genes that share ontologies with SH3BP5: view
genes like me logo Genes that share phenotypes with SH3BP5: view

Animal Models for SH3BP5 Gene

MGI Knock Outs for SH3BP5:

Animal Model Products

CRISPR Products

miRNA for SH3BP5 Gene

miRTarBase miRNAs that target SH3BP5

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for SH3BP5 Gene

Localization for SH3BP5 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SH3BP5 Gene


Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SH3BP5 gene
Compartment Confidence
mitochondrion 4
nucleus 3
cytosol 2
extracellular 1
cytoskeleton 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nuclear bodies (3)
  • Nucleoplasm (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for SH3BP5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005622 intracellular IEA --
GO:0005654 nucleoplasm IDA --
GO:0005737 cytoplasm TAS 9571151
GO:0005739 mitochondrion IEA --
GO:0016604 nuclear body IDA --
genes like me logo Genes that share ontologies with SH3BP5: view

Pathways & Interactions for SH3BP5 Gene

genes like me logo Genes that share pathways with SH3BP5: view

Pathways by source for SH3BP5 Gene

1 BioSystems pathway for SH3BP5 Gene

Gene Ontology (GO) - Biological Process for SH3BP5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006469 negative regulation of protein kinase activity IEA --
GO:0007165 signal transduction TAS 9571151
GO:0035556 intracellular signal transduction IDA,IEA 10339589
GO:0061099 negative regulation of protein tyrosine kinase activity IBA --
genes like me logo Genes that share ontologies with SH3BP5: view

No data available for SIGNOR curated interactions for SH3BP5 Gene

Drugs & Compounds for SH3BP5 Gene

(5) Drugs for SH3BP5 Gene - From: ApexBio and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
AVL-292 Pharma Btk inhibitor 0
CGI-1746 Pharma Btk inhibitor 0
RN486 Pharma Btk inhibitor,potent and selective 0

(3) ApexBio Compounds for SH3BP5 Gene

Compound Action Cas Number
AVL-292 Btk inhibitor 1202757-89-8
CGI-1746 Btk inhibitor 910232-84-7
RN486 Btk inhibitor,potent and selective 1242156-23-5
genes like me logo Genes that share compounds with SH3BP5: view

Drug Products

Transcripts for SH3BP5 Gene

Unigene Clusters for SH3BP5 Gene

SH3-domain binding protein 5 (BTK-associated):
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for SH3BP5 Gene

ExUns: 1 ^ 2a · 2b ^ 3 ^ 4a · 4b ^ 5a · 5b · 5c · 5d ^ 6 ^ 7 ^ 8a · 8b ^ 9 ^ 10 ^ 11a · 11b ^ 12a · 12b ^ 13 ^ 14a · 14b · 14c
SP1: - - - - - - - - -
SP2: - - - - - - - - -
SP3: - - - - - - - -
SP4: - - - - - -
SP5: - -
SP6: - - - - - -
SP7: -
SP8: - - -

Relevant External Links for SH3BP5 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SH3BP5 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SH3BP5 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for SH3BP5 Gene

This gene is overexpressed in Serum (24.7), Liver, secretome (11.0), Liver (9.6), and Lung (9.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for SH3BP5 Gene

NURSA nuclear receptor signaling pathways regulating expression of SH3BP5 Gene:


SOURCE GeneReport for Unigene cluster for SH3BP5 Gene:


mRNA Expression by UniProt/SwissProt for SH3BP5 Gene:

Tissue specificity: Highly expressed in testis and ovaries. It is also expressed in a variety of tissues including spleen, lymph node, thymus, bone marrow, fetal liver, colon, small intestine and prostate.

Evidence on tissue expression from TISSUES for SH3BP5 Gene

  • Adrenal gland(4.4)
  • Nervous system(4.3)
  • Lung(3.2)
  • Blood(2.2)
  • Kidney(2.2)
  • Skin(2.1)
  • Lymph node(2)
genes like me logo Genes that share expression patterns with SH3BP5: view

Primer Products

No data available for mRNA differential expression in normal tissues , Protein tissue co-expression partners and Phenotype-based relationships between genes and organs from Gene ORGANizer for SH3BP5 Gene

Orthologs for SH3BP5 Gene

This gene was present in the common ancestor of animals.

Orthologs for SH3BP5 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia SH3BP5 33 34
  • 99.56 (n)
(Canis familiaris)
Mammalia SH3BP5 33 34
  • 92.97 (n)
(Ornithorhynchus anatinus)
Mammalia SH3BP5 34
  • 89 (a)
(Rattus norvegicus)
Mammalia Sh3bp5 33
  • 88.35 (n)
(Mus musculus)
Mammalia Sh3bp5 33 16 34
  • 87.99 (n)
(Bos Taurus)
Mammalia SH3BP5 33 34
  • 82.7 (n)
(Monodelphis domestica)
Mammalia SH3BP5 34
  • 82 (a)
(Gallus gallus)
Aves SH3BP5 33 34
  • 78.16 (n)
(Anolis carolinensis)
Reptilia SH3BP5 34
  • 83 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia sh3bp5 33
  • 73.89 (n)
MGC75731 33
(Danio rerio)
Actinopterygii sh3bp5b 33 34
  • 73.87 (n)
Dr.7417 33
fruit fly
(Drosophila melanogaster)
Insecta pcs 35
  • 48 (a)
CG14408 34
  • 16 (a)
Species where no ortholog for SH3BP5 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for SH3BP5 Gene

Gene Tree for SH3BP5 (if available)
Gene Tree for SH3BP5 (if available)

Paralogs for SH3BP5 Gene

Paralogs for SH3BP5 Gene

(2) SIMAP similar genes for SH3BP5 Gene using alignment to 5 proteins:

genes like me logo Genes that share paralogs with SH3BP5: view

Variants for SH3BP5 Gene

Sequence variations from dbSNP and Humsavar for SH3BP5 Gene

SNP ID Clin Chr 03 pos Variation AA Info Type
rs1000062355 -- 15,336,474(-) GGAGATCCATTAGCCTGATG/G genic_upstream_transcript_variant, intron_variant
rs1000105699 -- 15,305,798(-) G/T intron_variant
rs1000140124 -- 15,260,004(-) A/G intron_variant
rs1000174705 -- 15,304,504(-) G/T intron_variant
rs1000175717 -- 15,257,496(-) C/G intron_variant

Structural Variations from Database of Genomic Variants (DGV) for SH3BP5 Gene

Variant ID Type Subtype PubMed ID
nsv834621 CNV gain 17160897
nsv524536 CNV loss 19592680
nsv522980 CNV loss 19592680
nsv428413 CNV gain 18775914
nsv1153248 CNV deletion 26484159
esv3951 CNV loss 18987735
esv3595383 CNV loss 21293372
esv3595382 CNV loss 21293372
esv2724963 CNV deletion 23290073
esv2724962 CNV deletion 23290073
esv2113465 CNV deletion 18987734
dgv852e199 CNV deletion 23128226

Variation tolerance for SH3BP5 Gene

Residual Variation Intolerance Score: 15.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.03; 50.20% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for SH3BP5 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SH3BP5 Gene

Disorders for SH3BP5 Gene

MalaCards: The human disease database

(7) MalaCards diseases for SH3BP5 Gene - From: HGMD, DISEASES, and Novoseek

Disorder Aliases PubMed IDs
endocardium disease
  • abnormality of the endocardium
tabes dorsalis
  • posterior spinal sclerosis
tertiary neurosyphilis
  • late neurosyphilis
agammaglobulinemia, x-linked
  • xla
tertiary syphilis
  • late syphilis
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for SH3BP5

genes like me logo Genes that share disorders with SH3BP5: view

No data available for UniProtKB/Swiss-Prot and Genatlas for SH3BP5 Gene

Publications for SH3BP5 Gene

  1. Bruton's tyrosine kinase activity is negatively regulated by Sab, the Btk-SH3 domain-binding protein. (PMID: 10339589) Yamadori T … Tsukada S (Proceedings of the National Academy of Sciences of the United States of America 1999) 2 3 4 22 58
  2. Identification and characterization of a novel SH3-domain binding protein, Sab, which preferentially associates with Bruton's tyrosine kinase (BtK). (PMID: 9571151) Matsushita M … Tsukada S (Biochemical and biophysical research communications 1998) 2 3 4 22 58
  3. A probability-based approach for high-throughput protein phosphorylation analysis and site localization. (PMID: 16964243) Beausoleil SA … Gygi SP (Nature biotechnology 2006) 3 4 58
  4. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58

Products for SH3BP5 Gene

Sources for SH3BP5 Gene

Loading form....