Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SGO2 Gene

Aliases for SGO2 Gene

  • Shugoshin 2 2 3 5
  • Shugoshin-Like 2 3 4
  • TRIPIN 3 4
  • SGOL2 3 4
  • Shugoshin-Like 2 (S. Pombe) 2
  • Shugoshin-2 4

External Ids for SGO2 Gene

Previous HGNC Symbols for SGO2 Gene

  • SGOL2

Summaries for SGO2 Gene

GeneCards Summary for SGO2 Gene

SGO2 (Shugoshin 2) is a Protein Coding gene. Diseases associated with SGO2 include Premature Ovarian Failure 1 and Perrault Syndrome. Among its related pathways are Signaling by Rho GTPases and Cell Cycle, Mitotic.

UniProtKB/Swiss-Prot for SGO2 Gene

  • Cooperates with PPP2CA to protect centromeric cohesin from separase-mediated cleavage in oocytes specifically during meiosis I. Has a crucial role in protecting REC8 at centromeres from cleavage by separase. During meiosis, protects centromeric cohesion complexes until metaphase II/anaphase II transition, preventing premature release of meiosis-specific REC8 cohesin complexes from anaphase I centromeres. Is thus essential for an accurate gametogenesis. May act by targeting PPP2CA to centromeres, thus leading to cohesin dephosphorylation (By similarity). Essential for recruiting KIF2C to the inner centromere and for correcting defective kinetochore attachments. Involved in centromeric enrichment of AUKRB in prometaphase.

Gene Wiki entry for SGO2 Gene

Additional gene information for SGO2 Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SGO2 Gene

Genomics for SGO2 Gene

GeneHancer (GH) Regulatory Elements for SGO2 Gene

Promoters and enhancers for SGO2 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH02I200525 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 560.5 +16.4 16380 2 HDGF PKNOX1 SMAD1 ARID4B SIN3A DMAP1 YY1 SLC30A9 POLR2B E2F8 SGO2 ORC2 AOX1 LOC100420110 LOC101927795 BZW1 KCTD18 PIR55109
GH02I200508 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 558.6 -0.1 -142 2.3 ARNT ZFP64 ARID4B SIN3A DMAP1 ZNF2 SLC30A9 ZNF207 ZNF143 SP3 SGO2 KCTD18 AOX1 LOC101927741
GH02I200962 Promoter/Enhancer 2.4 EPDnew FANTOM5 Ensembl ENCODE 10.2 +453.8 453798 3 HDGF PKNOX1 FOXA2 ARNT ARID4B SIN3A DMAP1 ZNF2 ZBTB7B YY1 ORC2 LOC105373835 PPIL3 CDK15 LOC100420110 KCTD18 SGO2 CLK1 CASP8 FAM126B
GH02I200585 Promoter/Enhancer 1.8 EPDnew Ensembl ENCODE 7.5 +76.3 76281 1.5 ELF3 ARID4B SIN3A DMAP1 ZNF48 ZBTB40 RAD21 YY1 THAP11 GMEB2 AOX1 SGO2 GC02P200578 GC02M200587
GH02I200614 Enhancer 1.2 Ensembl ENCODE dbSUPER 11.1 +107.4 107368 4.8 CTCF FOXA2 JUN MAX EBF1 BATF RAD21 YY1 TEAD3 GATA3 AOX1 SGO2 GC02M200587 GC02P200578
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SGO2 on UCSC Golden Path with GeneCards custom track

Genomic Locations for SGO2 Gene

Genomic Locations for SGO2 Gene
chr2:200,510,008-200,584,095
(GRCh38/hg38)
Size:
74,088 bases
Orientation:
Plus strand
chr2:201,374,731-201,448,818
(GRCh37/hg19)

Genomic View for SGO2 Gene

Genes around SGO2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SGO2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SGO2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SGO2 Gene

Proteins for SGO2 Gene

  • Protein details for SGO2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q562F6-SGO2_HUMAN
    Recommended name:
    Shugoshin 2
    Protein Accession:
    Q562F6
    Secondary Accessions:
    • Q53RR9
    • Q53T20
    • Q86XY4
    • Q8IWK2
    • Q8IZK1
    • Q8N1Q5
    • Q96LQ3

    Protein attributes for SGO2 Gene

    Size:
    1265 amino acids
    Molecular mass:
    144739 Da
    Quaternary structure:
    • Directly interacts with PPP2CA. Part of an astrin (SPAG5) -kinastrin (SKAP) complex containing KNSTRN, SPAG5, PLK1, DYNLL1 and SGO2. Interacts with CDCA8.
    Miscellaneous:
    • Shugoshin is Japanese for guardian spirit (as it is known to be a protector of centromeric cohesin).
    SequenceCaution:
    • Sequence=AAH35764.1; Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A sequence.; Evidence={ECO:0000305}; Sequence=BAB71617.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305}; Sequence=BAC04524.1; Type=Frameshift; Positions=649; Evidence={ECO:0000305};

    Alternative splice isoforms for SGO2 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for SGO2 Gene

Post-translational modifications for SGO2 Gene

No Post-translational modifications

No data available for DME Specific Peptides for SGO2 Gene

Domains & Families for SGO2 Gene

Gene Families for SGO2 Gene

Human Protein Atlas (HPA):
  • Plasma proteins
  • Predicted intracellular proteins

Protein Domains for SGO2 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for SGO2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q562F6

UniProtKB/Swiss-Prot:

SGO2_HUMAN :
  • Belongs to the shugoshin family.
Family:
  • Belongs to the shugoshin family.
genes like me logo Genes that share domains with SGO2: view

Function for SGO2 Gene

Molecular function for SGO2 Gene

UniProtKB/Swiss-Prot Function:
Cooperates with PPP2CA to protect centromeric cohesin from separase-mediated cleavage in oocytes specifically during meiosis I. Has a crucial role in protecting REC8 at centromeres from cleavage by separase. During meiosis, protects centromeric cohesion complexes until metaphase II/anaphase II transition, preventing premature release of meiosis-specific REC8 cohesin complexes from anaphase I centromeres. Is thus essential for an accurate gametogenesis. May act by targeting PPP2CA to centromeres, thus leading to cohesin dephosphorylation (By similarity). Essential for recruiting KIF2C to the inner centromere and for correcting defective kinetochore attachments. Involved in centromeric enrichment of AUKRB in prometaphase.

Phenotypes From GWAS Catalog for SGO2 Gene

Gene Ontology (GO) - Molecular Function for SGO2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 17485487
genes like me logo Genes that share ontologies with SGO2: view
genes like me logo Genes that share phenotypes with SGO2: view

Animal Model Products

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for SGO2 Gene

Localization for SGO2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SGO2 Gene

Nucleus. Chromosome, centromere. Chromosome, centromere, kinetochore. Note=During meiosis I, accumulates at centromeres during diplotene, and colocalizes differentially with the cohesin subunits RAD21 and REC8 at metaphase I centromeres (By similarity). SGO2 and RAD21 change their relative distributions during telophase I when sister-kinetochore association is lost (By similarity). During meiosis II, it shows a striking tension-dependent redistribution within centromeres throughout chromosome congression during prometaphase II, as it does during mitosis (By similarity). In Hela cells, localizes at centromeres throughout prophase until metaphase and disappears at anaphase (PubMed:17485487). Centromeric localization requires the presence of BUB1 and AUKRB (PubMed:17485487). {ECO:0000250 UniProtKB:Q7TSY8, ECO:0000269 PubMed:17485487}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SGO2 gene
Compartment Confidence
nucleus 5
cytosol 5
cytoskeleton 2
plasma membrane 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nucleoplasm (4)
  • Nuclear bodies (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for SGO2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000775 chromosome, centromeric region IDA 17485487
GO:0000776 kinetochore IEA --
GO:0000777 condensed chromosome kinetochore IEA --
GO:0005634 nucleus IEA --
GO:0005654 nucleoplasm IDA --
genes like me logo Genes that share ontologies with SGO2: view

Pathways & Interactions for SGO2 Gene

genes like me logo Genes that share pathways with SGO2: view

Pathways by source for SGO2 Gene

Gene Ontology (GO) - Biological Process for SGO2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007049 cell cycle IEA --
GO:0007059 chromosome segregation IEA --
GO:0007062 sister chromatid cohesion TAS --
GO:0051301 cell division IEA --
GO:0051321 meiotic cell cycle IEA --
genes like me logo Genes that share ontologies with SGO2: view

No data available for SIGNOR curated interactions for SGO2 Gene

Drugs & Compounds for SGO2 Gene

No Compound Related Data Available

Transcripts for SGO2 Gene

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for SGO2 Gene

No ASD Table

Relevant External Links for SGO2 Gene

GeneLoc Exon Structure for
SGO2
ECgene alternative splicing isoforms for
SGO2

Expression for SGO2 Gene

NURSA nuclear receptor signaling pathways regulating expression of SGO2 Gene:

SGO2

Evidence on tissue expression from TISSUES for SGO2 Gene

  • Intestine(4.1)
No Expression Related Data Available

Primer Products

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for SGO2 Gene

Orthologs for SGO2 Gene

This gene was present in the common ancestor of chordates.

Orthologs for SGO2 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia SGOL2 33 34
  • 99.42 (n)
dog
(Canis familiaris)
Mammalia SGOL2 33 34
  • 82.5 (n)
mouse
(Mus musculus)
Mammalia Sgol2 33 34
  • 75.38 (n)
Gm4975 34
  • 49 (a)
OneToMany
Sgo2b 16
rat
(Rattus norvegicus)
Mammalia Sgol2 33
  • 75 (n)
cow
(Bos Taurus)
Mammalia SGOL2 34
  • 65 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia SGOL2 34
  • 37 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia -- 34
  • 55 (a)
OneToMany
-- 34
  • 19 (a)
OneToMany
Species where no ortholog for SGO2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for SGO2 Gene

ENSEMBL:
Gene Tree for SGO2 (if available)
TreeFam:
Gene Tree for SGO2 (if available)

Paralogs for SGO2 Gene

No data available for Paralogs for SGO2 Gene

Variants for SGO2 Gene

Sequence variations from dbSNP and Humsavar for SGO2 Gene

SNP ID Clin Chr 02 pos Variation AA Info Type
rs1057519602 pathogenic, Perrault Syndrome, Premature ovarian failure 200,571,796(+) AGAGA/AGA coding_sequence_variant, frameshift
rs1000022653 -- 200,530,454(+) G/C intron_variant
rs1000042646 -- 200,543,687(+) A/T intron_variant
rs1000185162 -- 200,523,752(+) G/A genic_upstream_transcript_variant, intron_variant, upstream_transcript_variant
rs1000189418 -- 200,526,188(+) GCCGCAGCCGCTGCTGCTCGCCG/GCCG 5_prime_UTR_variant, genic_upstream_transcript_variant, upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for SGO2 Gene

Variant ID Type Subtype PubMed ID
esv6840 CNV gain 19470904

Variation tolerance for SGO2 Gene

Residual Variation Intolerance Score: 97.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.87; 74.10% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for SGO2 Gene

Human Gene Mutation Database (HGMD)
SGO2
SNPedia medical, phenotypic, and genealogical associations of SNPs for
SGO2

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SGO2 Gene

Disorders for SGO2 Gene

MalaCards: The human disease database

(3) MalaCards diseases for SGO2 Gene - From: HGMD, ClinVar, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
premature ovarian failure 1
  • pof1
perrault syndrome
  • gonadal dysgenesis, xx type
premature menopause
  • menopause - premature
- elite association - COSMIC cancer census association via MalaCards
Search SGO2 in MalaCards View complete list of genes associated with diseases
genes like me logo Genes that share disorders with SGO2: view

No data available for UniProtKB/Swiss-Prot and Genatlas for SGO2 Gene

Publications for SGO2 Gene

  1. Tripin/hSgo2 recruits MCAK to the inner centromere to correct defective kinetochore attachments. (PMID: 17485487) Huang H … Yen TJ (The Journal of cell biology 2007) 3 4 22 58
  2. Phosphorylation of the CPC by Cdk1 promotes chromosome bi-orientation. (PMID: 20739936) Tsukahara T … Watanabe Y (Nature 2010) 3 4 58
  3. Shugoshin collaborates with protein phosphatase 2A to protect cohesin. (PMID: 16541025) Kitajima TS … Watanabe Y (Nature 2006) 3 4 58
  4. Generation and annotation of the DNA sequences of human chromosomes 2 and 4. (PMID: 15815621) Hillier LW … Wilson RK (Nature 2005) 3 4 58
  5. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58

Products for SGO2 Gene

Sources for SGO2 Gene

Content
Loading form....