Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SDHA Gene

Aliases for SDHA Gene

  • Succinate Dehydrogenase Complex Flavoprotein Subunit A 2 3 5
  • Flavoprotein Subunit Of Complex II 2 3 4
  • Succinate Dehydrogenase Complex, Subunit A, Flavoprotein (Fp) 2 3
  • SDH2 3 4
  • SDHF 3 4
  • FP 3 4
  • Succinate Dehydrogenase [Ubiquinone] Flavoprotein Subunit, Mitochondrial 3
  • Succinate Dehydrogenase Complex Subunit A, Flavoprotein (Fp) 2
  • Succinate Dehydrogenase [Ubiquinone] Flavoprotein Subunit 2
  • EC 4
  • CMD1GG 3
  • PGL5 3
  • SDH1 3

External Ids for SDHA Gene

Previous HGNC Symbols for SDHA Gene

  • SDH2

Previous GeneCards Identifiers for SDHA Gene

  • GC05P000259
  • GC05P000271

Summaries for SDHA Gene

Entrez Gene Summary for SDHA Gene

  • This gene encodes a major catalytic subunit of succinate-ubiquinone oxidoreductase, a complex of the mitochondrial respiratory chain. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. Mutations in this gene have been associated with a form of mitochondrial respiratory chain deficiency known as Leigh Syndrome. A pseudogene has been identified on chromosome 3q29. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]

GeneCards Summary for SDHA Gene

SDHA (Succinate Dehydrogenase Complex Flavoprotein Subunit A) is a Protein Coding gene. Diseases associated with SDHA include Cardiomyopathy, Dilated, 1Gg and Paragangliomas 5. Among its related pathways are Respiratory electron transport, ATP synthesis by chemiosmotic coupling, and heat production by uncoupling proteins. and Pyruvate metabolism and Citric Acid (TCA) cycle. Gene Ontology (GO) annotations related to this gene include oxidoreductase activity and oxidoreductase activity, acting on the CH-CH group of donors.

UniProtKB/Swiss-Prot for SDHA Gene

  • Flavoprotein (FP) subunit of succinate dehydrogenase (SDH) that is involved in complex II of the mitochondrial electron transport chain and is responsible for transferring electrons from succinate to ubiquinone (coenzyme Q) (PubMed:24781757). Can act as a tumor suppressor (PubMed:20484225).

Gene Wiki entry for SDHA Gene

Additional gene information for SDHA Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SDHA Gene

Genomics for SDHA Gene

GeneHancer (GH) Regulatory Elements for SDHA Gene

Promoters and enhancers for SDHA Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH05I000217 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 575.2 +0.9 893 3.7 MLX ARID4B SIN3A ZBTB7B ZNF48 POLR2B GLIS2 ZNF213 ZNF207 ZNF143 SDHA CCDC127 ENSG00000260774 HRAT5 PDCD6 PIR59029
GH05I000270 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 25.6 +53.3 53336 2.6 PKNOX1 FOXA2 ARNT ZFP64 ARID4B SIN3A DMAP1 ZNF2 ZBTB7B IRF4 HRAT5 PDCD6 PIR51136 PIR36964 SDHA CCDC127
GH05I000187 Promoter/Enhancer 2.1 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 11.5 -27.9 -27910 5.6 HDGF PKNOX1 ARID4B SIN3A ZNF2 ZBTB7B YY1 GLIS2 ZNF143 KLF7 LRRC14B LOC100421419 SLC9A3-AS1 HRAT5 SDHA CCDC127 PLEKHG4B BRD9 EXOC3 PDCD6
GH05I000262 Enhancer 0.9 Ensembl ENCODE 24.7 +45.4 45434 2.5 FOXA2 JUN MAX MZF1 BRCA1 RFX5 YY1 TEAD3 RCOR1 MAFK SDHA HRAT5 PDCD6 CCDC127 PIR51136 PIR48092
GH05I000320 Promoter/Enhancer 1.3 Ensembl ENCODE 13.2 +104.0 104012 3.8 HDGF ARNT ZBTB7B RAD21 ZNF335 GLIS2 ZNF366 ZNF143 IKZF2 SMARCA5 HRAT5 SDHA CCDC127 PDCD6 AHRR GC05M000376
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around SDHA on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SDHA gene promoter:

Genomic Locations for SDHA Gene

Genomic Locations for SDHA Gene
46,594 bases
Plus strand

Genomic View for SDHA Gene

Genes around SDHA on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SDHA Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SDHA Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SDHA Gene

Proteins for SDHA Gene

  • Protein details for SDHA Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial
    Protein Accession:
    Secondary Accessions:
    • A8K5J6
    • B4DJ60
    • E9PBJ5
    • Q16395
    • Q59GW8
    • Q8IW48
    • Q9UMY5

    Protein attributes for SDHA Gene

    664 amino acids
    Molecular mass:
    72692 Da
    Name=FAD; Xref=ChEBI:CHEBI:57692;
    Quaternary structure:
    • Component of complex II composed of four subunits: the flavoprotein (FP) SDHA, iron-sulfur protein (IP) SDHB, and a cytochrome b560 composed of SDHC and SDHD (By similarity). Interacts with SDHAF2/SDH5; interaction is required for FAD attachment (PubMed:19628817). Interacts with TRAP1 (PubMed:23747254).
    • Sequence=BAD92228.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305}; Sequence=CAA37886.1; Type=Miscellaneous discrepancy; Note=Differs extensively from that shown.; Evidence={ECO:0000305};

    Alternative splice isoforms for SDHA Gene


neXtProt entry for SDHA Gene

Post-translational modifications for SDHA Gene

  • Acetylated. Deacetylated by SIRT3.
  • Phosphorylation at Tyr-215 is important for efficient electron transfer in complex II and the prevention of ROS generation.
  • Ubiquitination at isoforms=2, 392, posLast=335335, and isoforms=2, 3608

No data available for DME Specific Peptides for SDHA Gene

Domains & Families for SDHA Gene

Gene Families for SDHA Gene

Human Protein Atlas (HPA):
  • Cancer-related genes
  • Disease related genes
  • Enzymes
  • Plasma proteins
  • Potential drug targets
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for SDHA Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the FAD-dependent oxidoreductase 2 family. FRD/SDH subfamily.
  • Belongs to the FAD-dependent oxidoreductase 2 family. FRD/SDH subfamily.
genes like me logo Genes that share domains with SDHA: view

Function for SDHA Gene

Molecular function for SDHA Gene

GENATLAS Biochemistry:
succinate dehydrogenase,flavoprotein,inner mitochondrial membrane,component,70kDa,of complex II of mitochondrial respiratory chain,oxidative phosphorylation,(OXPHOS),also catalyzing the seventh step of the citric acid cycle
UniProtKB/Swiss-Prot CatalyticActivity:
Succinate + a quinone = fumarate + a quinol.
UniProtKB/Swiss-Prot Function:
Flavoprotein (FP) subunit of succinate dehydrogenase (SDH) that is involved in complex II of the mitochondrial electron transport chain and is responsible for transferring electrons from succinate to ubiquinone (coenzyme Q) (PubMed:24781757). Can act as a tumor suppressor (PubMed:20484225).

Enzyme Numbers (IUBMB) for SDHA Gene

Phenotypes From GWAS Catalog for SDHA Gene

Gene Ontology (GO) - Molecular Function for SDHA Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000104 contributes_to succinate dehydrogenase activity IMP 7550341
GO:0005515 protein binding IPI 15961414
GO:0008177 succinate dehydrogenase (ubiquinone) activity IMP 24781757
GO:0009055 electron transfer activity IBA --
GO:0016491 oxidoreductase activity IEA --
genes like me logo Genes that share ontologies with SDHA: view
genes like me logo Genes that share phenotypes with SDHA: view

Human Phenotype Ontology for SDHA Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for SDHA Gene

MGI Knock Outs for SDHA:
  • Sdha tm2b(KOMP)Wtsi

Animal Model Products

CRISPR Products

Inhibitory RNA Products

No data available for Transcription Factor Targets and HOMER Transcription for SDHA Gene

Localization for SDHA Gene

Subcellular locations from UniProtKB/Swiss-Prot for SDHA Gene

Mitochondrion inner membrane; Peripheral membrane protein; Matrix side.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SDHA gene
Compartment Confidence
mitochondrion 5
nucleus 5

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for SDHA Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005730 nucleolus IDA --
GO:0005739 mitochondrion IDA 7550341
GO:0005743 mitochondrial inner membrane TAS --
GO:0005749 mitochondrial respiratory chain complex II, succinate dehydrogenase complex (ubiquinone) TAS 7550341
GO:0016020 membrane IEA --
genes like me logo Genes that share ontologies with SDHA: view

Pathways & Interactions for SDHA Gene

genes like me logo Genes that share pathways with SDHA: view

UniProtKB/Swiss-Prot P31040-SDHA_HUMAN

  • Pathway: Carbohydrate metabolism; tricarboxylic acid cycle; fumarate from succinate (eukaryal route): step 1/1.

Gene Ontology (GO) - Biological Process for SDHA Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006099 tricarboxylic acid cycle TAS 7550341
GO:0006105 succinate metabolic process IDA 7550341
GO:0006121 mitochondrial electron transport, succinate to ubiquinone IBA --
GO:0007399 nervous system development IMP 16361598
GO:0009061 anaerobic respiration IBA --
genes like me logo Genes that share ontologies with SDHA: view

No data available for SIGNOR curated interactions for SDHA Gene

Drugs & Compounds for SDHA Gene

(12) Drugs for SDHA Gene - From: DrugBank, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Coenzyme Q10 Approved, Investigational Nutra Target, cofactor 129
Succinic acid Approved Nutra Full agonist, Agonist, Target 0
Carboxin Approved, Experimental, Investigational Pharma Target 0
FAD Approved Pharma 0
Ubiquinone-1 Experimental Pharma Target 0

(10) Additional Compounds for SDHA Gene - From: HMDB and Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • Armco iron
  • Carbonyl iron
  • FE
  • Ferrovac e
  • Hematite
  • Coenzymes QH2
  • CoQH2
  • Reduced ubiquinone
  • Ubiquinol
  • Ubiquinone-1
  • Sulfanediide
  • Sulfide
  • Sulfur
  • Sulphide
Ubiquinol 8
  • Ubiquinol(8)
  • Ubiquinol-8
genes like me logo Genes that share compounds with SDHA: view

Transcripts for SDHA Gene

Unigene Clusters for SDHA Gene

Succinate dehydrogenase complex, subunit A, flavoprotein (Fp):
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Alternative Splicing Database (ASD) splice patterns (SP) for SDHA Gene

No ASD Table

Relevant External Links for SDHA Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SDHA Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SDHA Gene

mRNA differential expression in normal tissues according to GTEx for SDHA Gene

This gene is overexpressed in Heart - Left Ventricle (x6.6).

Protein differential expression in normal tissues from HIPED for SDHA Gene

This gene is overexpressed in Heart (11.4).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for SDHA Gene

Protein tissue co-expression partners for SDHA Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of SDHA Gene:


SOURCE GeneReport for Unigene cluster for SDHA Gene:


Evidence on tissue expression from TISSUES for SDHA Gene

  • Nervous system(5)
  • Intestine(4.9)
  • Heart(4.7)
  • Liver(4.6)
  • Kidney(4)
  • Lung(3.9)
  • Skin(3.4)
  • Muscle(3)
  • Adrenal gland(2.9)
  • Eye(2.8)
  • Blood(2.5)
  • Stomach(2.3)
  • Thyroid gland(2.1)
  • Lymph node(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for SDHA Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • cardiovascular
  • digestive
  • endocrine
  • immune
  • integumentary
  • nervous
  • respiratory
  • skeletal muscle
  • skeleton
  • urinary
Head and neck:
  • brain
  • cerebellum
  • cerebrospinal fluid
  • cranial nerve
  • ear
  • eye
  • eyelid
  • face
  • head
  • larynx
  • meninges
  • middle ear
  • mouth
  • neck
  • nose
  • outer ear
  • pharynx
  • thyroid
  • tongue
  • vocal cord
  • esophagus
  • heart
  • heart valve
  • lung
  • trachea
  • adrenal gland
  • intestine
  • kidney
  • large intestine
  • liver
  • small intestine
  • stomach
  • rectum
  • urinary bladder
  • ankle
  • digit
  • elbow
  • finger
  • foot
  • hand
  • hip
  • knee
  • lower limb
  • shoulder
  • toe
  • upper limb
  • wrist
  • blood
  • blood vessel
  • coagulation system
  • hair
  • peripheral nerve
  • peripheral nervous system
  • red blood cell
  • skin
  • spinal cord
  • sweat gland
genes like me logo Genes that share expression patterns with SDHA: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA Expression by UniProt/SwissProt for SDHA Gene

Orthologs for SDHA Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for SDHA Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia SDHA 33 34
  • 99.25 (n)
(Ornithorhynchus anatinus)
Mammalia SDHA 34
  • 92 (a)
(Monodelphis domestica)
Mammalia SDHA 34
  • 91 (a)
(Canis familiaris)
Mammalia SDHA 33 34
  • 89.06 (n)
(Mus musculus)
Mammalia Sdha 33 16 34
  • 86.65 (n)
(Rattus norvegicus)
Mammalia Sdha 33
  • 86.38 (n)
(Bos Taurus)
Mammalia SDHA 33 34
  • 84.59 (n)
(Gallus gallus)
Aves SDHA 33 34
  • 77.96 (n)
(Anolis carolinensis)
Reptilia SDHA 34
  • 88 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia sdha 33
  • 74.26 (n)
Str.9006 33
African clawed frog
(Xenopus laevis)
Amphibia MGC68518 33
(Danio rerio)
Actinopterygii sdha 33 34
  • 74.33 (n)
zgc56051 33
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.337 33
fruit fly
(Drosophila melanogaster)
Insecta Scs-fp 35
  • 73 (a)
SdhA 33 34
  • 68.13 (n)
CG5718 35
  • 61 (a)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP010429 33
  • 68.34 (n)
(Caenorhabditis elegans)
Secernentea C03G5.1 35
  • 72 (a)
C34B2.7 35
  • 71 (a)
sdha-1 33
  • 64.52 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes -- 34
  • 65 (a)
SDH1 33
  • 61.93 (n)
-- 36
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_ACR052W 33
  • 62.62 (n)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0D04444g 33
  • 59.68 (n)
thale cress
(Arabidopsis thaliana)
eudicotyledons SDH1-1 33
  • 64.04 (n)
Alicante grape
(Vitis vinifera)
eudicotyledons Vvi.10042 33
(Oryza sativa)
Liliopsida Os07g0134800 33
  • 63.23 (n)
Os.22581 33
(Triticum aestivum)
Liliopsida Ta.3416 33
(Zea mays)
Liliopsida Zm.16820 33
bread mold
(Neurospora crassa)
Ascomycetes NCU08336 33
  • 63.88 (n)
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes sdh1 33
  • 62.64 (n)
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.2710 33
Species where no ortholog for SDHA was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)

Evolution for SDHA Gene

Gene Tree for SDHA (if available)
Gene Tree for SDHA (if available)

Paralogs for SDHA Gene

No data available for Paralogs for SDHA Gene

Variants for SDHA Gene

Sequence variations from dbSNP and Humsavar for SDHA Gene

SNP ID Clin Chr 05 pos Variation AA Info Type
rs1017441235 uncertain-significance, Mitochondrial complex II deficiency, Paragangliomas 5 254,498(+) A/G/T coding_sequence_variant, missense_variant
rs1041809852 likely-pathogenic, Mitochondrial complex II deficiency, Paragangliomas 5 228,324(+) TTGCCACAGGGTAGGAATCTCATTTCT/T coding_sequence_variant, intron_variant, splice_donor_variant
rs1041948 uncertain-significance, Hereditary cancer-predisposing syndrome 233,618(+) C/G/T coding_sequence_variant, missense_variant
rs1041949 conflicting-interpretations-of-pathogenicity, benign, likely-benign, not specified, Hereditary cancer-predisposing syndrome, Mitochondrial complex II deficiency, Pheochromocytoma, Leigh syndrome 233,619(+) C/G/T coding_sequence_variant, synonymous_variant
rs1041950 uncertain-significance, likely-benign, Mitochondrial complex II deficiency, Paragangliomas 5, Hereditary cancer-predisposing syndrome 235,255(+) C/T coding_sequence_variant, synonymous_variant

Structural Variations from Database of Genomic Variants (DGV) for SDHA Gene

Variant ID Type Subtype PubMed ID
nsv968130 CNV duplication 23825009
nsv964813 CNV duplication 23825009
nsv964812 CNV duplication 23825009
nsv964811 CNV duplication 23825009
nsv596611 CNV loss 21841781
nsv523382 CNV loss 19592680
nsv518607 CNV gain 19592680
nsv428458 CNV loss 18775914
nsv1147234 OTHER inversion 26484159
nsv1143120 CNV tandem duplication 24896259
nsv1133013 OTHER inversion 24896259
nsv1109668 CNV deletion 24896259
nsv10645 CNV loss 18304495
nsv10644 CNV gain+loss 18304495
nsv1030767 CNV gain 25217958
nsv1028658 CNV gain 25217958
nsv1018482 CNV loss 25217958
nsv1018481 CNV gain 25217958
esv3894107 CNV gain 25118596
esv3603737 CNV gain 21293372
esv3603736 CNV loss 21293372
esv3569901 CNV loss 25503493
esv3569900 CNV loss 25503493
esv3569895 CNV loss 25503493
esv3569892 CNV loss 25503493
esv3565293 CNV deletion 23714750
esv2763907 CNV gain+loss 21179565
esv2759315 CNV loss 17122850
esv2752083 CNV gain 17911159
dgv3009n106 CNV deletion 24896259
dgv1559e212 CNV loss 25503493

Variation tolerance for SDHA Gene

Residual Variation Intolerance Score: 16.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 6.69; 78.59% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for SDHA Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SDHA Gene

Disorders for SDHA Gene

MalaCards: The human disease database

(22) MalaCards diseases for SDHA Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
cardiomyopathy, dilated, 1gg
  • cmd1gg
paragangliomas 5
  • pgl5
mitochondrial complex ii deficiency
  • succinate coq reductase deficiency
familial isolated dilated cardiomyopathy
  • familial or idiopathic dilated cardiomyopathy
leigh syndrome
  • ls
- elite association - COSMIC cancer census association via MalaCards
Search SDHA in MalaCards View complete list of genes associated with diseases


  • Cardiomyopathy, dilated 1GG (CMD1GG) [MIM:613642]: A disorder characterized by ventricular dilation and impaired systolic function, resulting in congestive heart failure and arrhythmia. Patients are at risk of premature death. {ECO:0000269 PubMed:20551992}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Leigh syndrome (LS) [MIM:256000]: An early-onset progressive neurodegenerative disorder characterized by the presence of focal, bilateral lesions in one or more areas of the central nervous system including the brainstem, thalamus, basal ganglia, cerebellum and spinal cord. Clinical features depend on which areas of the central nervous system are involved and include subacute onset of psychomotor retardation, hypotonia, ataxia, weakness, vision loss, eye movement abnormalities, seizures, and dysphagia. {ECO:0000269 PubMed:10746566, ECO:0000269 PubMed:24781757, ECO:0000269 PubMed:7550341}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Mitochondrial complex II deficiency (MT-C2D) [MIM:252011]: A disorder of the mitochondrial respiratory chain with heterogeneous clinical manifestations. Clinical features include psychomotor regression in infants, poor growth with lack of speech development, severe spastic quadriplegia, dystonia, progressive leukoencephalopathy, muscle weakness, exercise intolerance, cardiomyopathy. Some patients manifest Leigh syndrome or Kearns-Sayre syndrome. Note=The disease is caused by mutations affecting the gene represented in this entry. {ECO:0000269 PubMed:12794685}.
  • Paragangliomas 5 (PGL5) [MIM:614165]: A neural crest tumor usually derived from the chromoreceptor tissue of a paraganglion. Paragangliomas can develop at various body sites, including the head, neck, thorax and abdomen. Most commonly, they are located in the head and neck region, specifically at the carotid bifurcation, the jugular foramen, the vagal nerve, and in the middle ear. {ECO:0000269 PubMed:20484225}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Genatlas disease for SDHA Gene

lactate acidosis,Leigh syndrome presenting as a leukodystrophy

Additional Disease Information for SDHA

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with SDHA: view

Publications for SDHA Gene

  1. Human complex II (succinate-ubiquinone oxidoreductase): cDNA cloning of the flavoprotein (Fp) subunit of liver mitochondria. (PMID: 7798181) Hirawake H … Kita K (Journal of biochemistry 1994) 2 3 4 22 58
  2. Single nucleotide polymorphisms in succinate dehydrogenase subunits and citrate synthase genes: association results for impaired spermatogenesis. (PMID: 17298551) Bonache S … Larriba S (International journal of andrology 2007) 3 22 44 58
  3. Homozygous Gly555Glu mutation in the nuclear-encoded 70 kDa flavoprotein gene causes instability of the respiratory chain complex II. (PMID: 12794685) Van Coster R … Lissens W (American journal of medical genetics. Part A 2003) 3 4 22 58
  4. Compound heterozygous mutations in the flavoprotein gene of the respiratory chain complex II in a patient with Leigh syndrome. (PMID: 10746566) Parfait B … Rustin P (Human genetics 2000) 3 4 22 58
  5. SDHA mutations causing a multisystem mitochondrial disease: novel mutations and genetic overlap with hereditary tumors. (PMID: 24781757) Renkema GH … Rodenburg RJ (European journal of human genetics : EJHG 2015) 3 4 58

Products for SDHA Gene

  • Addgene plasmids for SDHA

Sources for SDHA Gene

Loading form....