Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SCAMP4 Gene

Aliases for SCAMP4 Gene

  • Secretory Carrier Membrane Protein 4 2 3 4 5
  • Secretory Carrier-Associated Membrane Protein 4 3 4
  • SCAMP-4 3

External Ids for SCAMP4 Gene

Previous GeneCards Identifiers for SCAMP4 Gene

  • GC19P001859
  • GC19P001860
  • GC19P001862
  • GC19P001676

Summaries for SCAMP4 Gene

Entrez Gene Summary for SCAMP4 Gene

  • Secretory carrier membrane proteins (SCAMPs) are widely distributed integral membrane proteins implicated in membrane trafficking. Most SCAMPs (e.g., SCAMP1; MIM 606911) have N-terminal cytoplasmic NPF (arg-pro-phe) repeats, 4 central transmembrane regions, and a short C-terminal cytoplasmic tail. These SCAMPs likely have a role in endocytosis that is mediated by their NPF repeats. Other SCAMPs, such as SCAMP4, lack the NPF repeats and are therefore unlikely to function in endocytosis (summary by Fernandez-Chacon and Sudhof, 2000 [PubMed 11050114]).[supplied by OMIM, Feb 2011]

GeneCards Summary for SCAMP4 Gene

SCAMP4 (Secretory Carrier Membrane Protein 4) is a Protein Coding gene. Diseases associated with SCAMP4 include Mental Retardation, Autosomal Recessive 36. An important paralog of this gene is SCAMP5.

UniProtKB/Swiss-Prot for SCAMP4 Gene

Additional gene information for SCAMP4 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SCAMP4 Gene

Genomics for SCAMP4 Gene

GeneHancer (GH) Regulatory Elements for SCAMP4 Gene

Promoters and enhancers for SCAMP4 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH19J001901 Promoter/Enhancer 2.5 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 607.6 -1.4 -1400 5 HDGF CC2D1A SP1 ELF3 ZFX MNT SIX5 CBFA2T2 ZNF148 NKRF ADAT3 SCAMP4 GC19P001907 SF3A2 TMEM259 DAZAP1 LOC100288123 TCF3 ENSG00000267317 DOT1L
GH19J001745 Promoter/Enhancer 2 FANTOM5 Ensembl ENCODE dbSUPER 20.7 -157.3 -157253 5.2 ZNF473 SP1 ZFX CC2D1A ZNF148 MLLT1 CDC5L ZBTB7A TRIM24 SP7 ENSG00000267073 CIRBP SPPL2B AP3D1 SCAMP4 PWWP3A SLC39A3 C19orf24 ATP8B3 REXO1
GH19J001202 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 14.9 -698.6 -698615 8 HDGF ZNF652 ZFX SP1 CC2D1A ELF3 ZKSCAN8 MNT CBFA2T2 ZNF148 STK11 CIRBP TMEM259 DAZAP1 LOC100288123 TCF3 PTBP1 GRIN3B DOT1L POLRMT
GH19J001236 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 11.3 -648.6 -648569 41.2 HDGF MTA3 SP1 ZFX CC2D1A ZNF652 ELF3 CTCF MNT SIX5 CIRBP C19orf24 MIDN CBARP ATP5F1D SF3A2 TMEM259 TCF3 LOC100288123 DAZAP1
GH19J001097 Promoter/Enhancer 2.6 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 11.1 -802.5 -802541 10.5 HDGF SP1 ZFX ELF3 MNT CBFA2T2 ZNF148 NKRF POLR2A MLLT1 GPX4 CIRBP TMEM259 DAZAP1 GRIN3B MIER2 LOC100288123 SCAMP4 TCF3 ENSG00000267317
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around SCAMP4 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the SCAMP4 gene promoter:
  • ATF
  • c-Myc
  • E47
  • Max
  • Max1
  • Olf-1
  • Pax-5
  • Tal-1
  • ZID

Genomic Locations for SCAMP4 Gene

Genomic Locations for SCAMP4 Gene
20,642 bases
Plus strand
20,804 bases
Plus strand

Genomic View for SCAMP4 Gene

Genes around SCAMP4 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SCAMP4 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SCAMP4 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SCAMP4 Gene

Proteins for SCAMP4 Gene

  • Protein details for SCAMP4 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Secretory carrier-associated membrane protein 4
    Protein Accession:
    Secondary Accessions:
    • Q8N2N1
    • Q8NAV0

    Protein attributes for SCAMP4 Gene

    229 amino acids
    Molecular mass:
    25728 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for SCAMP4 Gene


neXtProt entry for SCAMP4 Gene

Post-translational modifications for SCAMP4 Gene

  • Ubiquitination at isoforms=2185
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for SCAMP4 Gene

Domains & Families for SCAMP4 Gene

Gene Families for SCAMP4 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins
  • Predicted membrane proteins

Protein Domains for SCAMP4 Gene


Suggested Antigen Peptide Sequences for SCAMP4 Gene

GenScript: Design optimal peptide antigens:
  • Secretory carrier-associated membrane protein 4 (SCAM4_HUMAN)

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the SCAMP family.
  • Belongs to the SCAMP family.
genes like me logo Genes that share domains with SCAMP4: view

Function for SCAMP4 Gene

Molecular function for SCAMP4 Gene

UniProtKB/Swiss-Prot Function:
Probably involved in membrane protein trafficking.

Phenotypes From GWAS Catalog for SCAMP4 Gene

genes like me logo Genes that share phenotypes with SCAMP4: view

Animal Model Products

  • Taconic Biosciences Mouse Models for SCAMP4

CRISPR Products

miRNA for SCAMP4 Gene

miRTarBase miRNAs that target SCAMP4

Clone Products

  • Applied Biological Materials (abm): Clones for SCAMP4 - Now 50% OFF >
  • * SCAMP4 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * SCAMP4 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for SCAMP4 Gene

Localization for SCAMP4 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SCAMP4 Gene

Membrane; Multi-pass membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for SCAMP4 gene
Compartment Confidence
golgi apparatus 4
plasma membrane 3
endosome 3

Subcellular locations from the

Human Protein Atlas (HPA)
  • Golgi apparatus (2)
  • Lipid droplets (2)
  • Plasma membrane (2)
  • Vesicles (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for SCAMP4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000139 Golgi membrane IBA 21873635
GO:0005794 Golgi apparatus IBA 21873635
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
GO:0032588 trans-Golgi network membrane IBA 21873635
genes like me logo Genes that share ontologies with SCAMP4: view

Pathways & Interactions for SCAMP4 Gene

PathCards logo

SuperPathways for SCAMP4 Gene

No Data Available

Interacting Proteins for SCAMP4 Gene

Gene Ontology (GO) - Biological Process for SCAMP4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0015031 protein transport IBA 21873635
genes like me logo Genes that share ontologies with SCAMP4: view

No data available for Pathways by source and SIGNOR curated interactions for SCAMP4 Gene

Drugs & Compounds for SCAMP4 Gene

No Compound Related Data Available

Transcripts for SCAMP4 Gene

Unigene Clusters for SCAMP4 Gene

Secretory carrier membrane protein 4:
Representative Sequences:

CRISPR Products

Clone Products

  • Applied Biological Materials (abm): Clones for SCAMP4 - Now 50% OFF >
  • * SCAMP4 as ready-to-use vector or virus: ORF | Lenti- | Retro- | Adeno- | AAV- | Protein Vector - Browse All
  • * SCAMP4 tags and reporters available: His, HA, Myc, Flag, GFP, RFP, Luciferase - Browse All

Alternative Splicing Database (ASD) splice patterns (SP) for SCAMP4 Gene

No ASD Table

Relevant External Links for SCAMP4 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SCAMP4 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for SCAMP4 Gene

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for SCAMP4 Gene

Protein tissue co-expression partners for SCAMP4 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of SCAMP4 Gene:


SOURCE GeneReport for Unigene cluster for SCAMP4 Gene:


Evidence on tissue expression from TISSUES for SCAMP4 Gene

  • Nervous system(4.9)
  • Kidney(2)
genes like me logo Genes that share expression patterns with SCAMP4: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for SCAMP4 Gene

Orthologs for SCAMP4 Gene

This gene was present in the common ancestor of animals.

Orthologs for SCAMP4 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia SCAMP4 35 34
  • 97.93 (n)
(Canis familiaris)
Mammalia SCAMP4 35 34
  • 89.37 (n)
(Bos Taurus)
Mammalia SCAMP4 35 34
  • 87.48 (n)
(Rattus norvegicus)
Mammalia Scamp4 34
  • 83.55 (n)
(Mus musculus)
Mammalia Scamp4 17 35 34
  • 82.82 (n)
(Monodelphis domestica)
Mammalia SCAMP4 35
  • 76 (a)
(Ornithorhynchus anatinus)
Mammalia SCAMP4 35
  • 72 (a)
(Gallus gallus)
Aves SCAMP4 35 34
  • 75.84 (n)
(Danio rerio)
Actinopterygii scamp4 35 34
  • 61.26 (n)
fruit fly
(Drosophila melanogaster)
Insecta Scamp 35
  • 29 (a)
(Caenorhabditis elegans)
Secernentea scm-1 35
  • 27 (a)
Species where no ortholog for SCAMP4 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for SCAMP4 Gene

Gene Tree for SCAMP4 (if available)
Gene Tree for SCAMP4 (if available)
Evolutionary constrained regions (ECRs) for SCAMP4: view image

Paralogs for SCAMP4 Gene

Paralogs for SCAMP4 Gene

(4) SIMAP similar genes for SCAMP4 Gene using alignment to 3 proteins:

genes like me logo Genes that share paralogs with SCAMP4: view

Variants for SCAMP4 Gene

Sequence variations from dbSNP and Humsavar for SCAMP4 Gene

SNP ID Clin Chr 19 pos Variation AA Info Type
rs146212621 likely-benign, not specified, not provided 1,912,901(+) A/C/G intron_variant
rs730882213 pathogenic, Mental retardation, autosomal recessive 36, not provided 1,912,477(+) G/A intron_variant
rs746859902 pathogenic, Mental retardation, autosomal recessive 36 1,912,142(+) CCGGGAGCCCGG/CCGGGAGCCCGGGAGCCCGG intron_variant
rs1057520060 uncertain-significance, not provided 1,912,651(+) C/T intron_variant
rs139117131 uncertain-significance, not provided 1,912,595(+) C/T intron_variant

Structural Variations from Database of Genomic Variants (DGV) for SCAMP4 Gene

Variant ID Type Subtype PubMed ID
dgv1685n106 CNV deletion 24896259
esv2571215 CNV insertion 19546169
esv2675682 CNV deletion 23128226
esv2717853 CNV deletion 23290073
esv2717854 CNV deletion 23290073
esv2717855 CNV deletion 23290073
esv32942 CNV gain+loss 17666407
esv3643413 CNV loss 21293372
esv3893156 CNV loss 25118596
nsv1160560 CNV deletion 26073780
nsv1160561 CNV deletion 26073780
nsv470107 CNV loss 18288195
nsv518629 CNV loss 19592680
nsv953942 CNV deletion 24416366

Variation tolerance for SCAMP4 Gene

Residual Variation Intolerance Score: 65% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.96; 36.30% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for SCAMP4 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SCAMP4 Gene

Disorders for SCAMP4 Gene

MalaCards: The human disease database

(1) MalaCards diseases for SCAMP4 Gene - From: GeneCards

Disorder Aliases PubMed IDs
mental retardation, autosomal recessive 36
  • mrt36
- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for SCAMP4

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with SCAMP4: view

No data available for UniProtKB/Swiss-Prot and Genatlas for SCAMP4 Gene

Publications for SCAMP4 Gene

  1. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose JE … Uhl GR (Molecular medicine (Cambridge, Mass.) 2010) 3 45 58
  2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
  4. SCAMP4 enhances the senescent cell secretome. (PMID: 29967290) Kim KM … Gorospe M (Genes & development 2018) 3 58
  5. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 58

Products for SCAMP4 Gene

Sources for SCAMP4 Gene

Loading form....