This gene is a member of the RUNX family of transcription factors and encodes a nuclear protein with an Runt DNA-binding domain. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affini... See more...

Aliases for RUNX2 Gene

Aliases for RUNX2 Gene

  • RUNX Family Transcription Factor 2 2 3 5
  • Runt-Related Transcription Factor 2 2 3 4
  • AML3 2 3 4
  • Polyomavirus Enhancer-Binding Protein 2 Alpha A Subunit 3 4
  • SL3/AKV Core-Binding Factor Alpha A Subunit 3 4
  • Osteoblast-Specific Transcription Factor 2 3 4
  • SL3-3 Enhancer Factor 1 Alpha A Subunit 3 4
  • Runt Related Transcription Factor 2 2 3
  • Acute Myeloid Leukemia 3 Protein 3 4
  • Oncogene AML-3 3 4
  • PEBP2-Alpha A 3 4
  • PEA2-Alpha A 3 4
  • CBF-Alpha-1 3 4
  • CBFA1 3 4
  • OSF-2 3 4
  • OSF2 3 4
  • Core-Binding Factor, Runt Domain, Alpha Subunit 1 3
  • Core-Binding Factor Subunit Alpha-1 4
  • PEBP2aA1 2
  • PEBP2aA 3
  • PEBP2A1 2
  • PEA2aA 3
  • PEBP2A 4
  • RUNX2 5
  • CCD1 3
  • CLCD 3
  • CCD 3

External Ids for RUNX2 Gene

Previous HGNC Symbols for RUNX2 Gene

  • CCD
  • CBFA1
  • CCD1

Previous GeneCards Identifiers for RUNX2 Gene

  • GC06P045392
  • GC06P045437
  • GC06P045498
  • GC06P045295
  • GC06P045018
  • GC06P045327
  • GC06P047551
  • GC06P049605

Summaries for RUNX2 Gene

Entrez Gene Summary for RUNX2 Gene

  • This gene is a member of the RUNX family of transcription factors and encodes a nuclear protein with an Runt DNA-binding domain. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Two regions of potential trinucleotide repeat expansions are present in the N-terminal region of the encoded protein, and these and other mutations in this gene have been associated with the bone development disorder cleidocranial dysplasia (CCD). Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Jul 2016]

GeneCards Summary for RUNX2 Gene

RUNX2 (RUNX Family Transcription Factor 2) is a Protein Coding gene. Diseases associated with RUNX2 include Cleidocranial Dysplasia and Metaphyseal Dysplasia With Maxillary Hypoplasia With Or Without Brachydactyly. Among its related pathways are Notch-mediated HES/HEY network and Androgen receptor signaling pathway. Gene Ontology (GO) annotations related to this gene include DNA-binding transcription factor activity and RNA polymerase II proximal promoter sequence-specific DNA binding. An important paralog of this gene is RUNX1.

UniProtKB/Swiss-Prot Summary for RUNX2 Gene

  • Transcription factor involved in osteoblastic differentiation and skeletal morphogenesis (PubMed:28505335, PubMed:28738062, PubMed:28703881). Essential for the maturation of osteoblasts and both intramembranous and endochondral ossification. CBF binds to the core site, 5'-PYGPYGGT-3', of a number of enhancers and promoters, including murine leukemia virus, polyomavirus enhancer, T-cell receptor enhancers, osteocalcin, osteopontin, bone sialoprotein, alpha 1(I) collagen, LCK, IL-3 and GM-CSF promoters. In osteoblasts, supports transcription activation: synergizes with SPEN/MINT to enhance FGFR2-mediated activation of the osteocalcin FGF-responsive element (OCFRE) (By similarity). Inhibits KAT6B-dependent transcriptional activation.

Gene Wiki entry for RUNX2 Gene

No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for RUNX2 Gene

Genomics for RUNX2 Gene

GeneHancer (GH) Regulatory Elements Pubs

Promoters and enhancers for RUNX2 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH06J045419 Promoter/Enhancer 2.4 EPDnew FANTOM5 Ensembl ENCODE CraniofacialAtlas dbSUPER 255.9 +95.0 95044 8.4 ZNF654 MYC ZNF600 ZNF10 ZIC2 ZBTB10 NONO CTCF REST BHLHE40 SUPT3H ENSG00000271857 RUNX2 HSALNG0050325 CLIC5
GH06J045327 Promoter/Enhancer 1.4 UCNEbase Ensembl ENCODE CraniofacialAtlas 250.7 +0.9 867 2.8 PRDM6 JUND ZNF652 ZBTB21 PRDM4 POLR2A TAF1 PRDM10 PRDM1 ZNF335 RUNX2 SUPT3H lnc-ENPP4-3 lnc-CLIC5-3
GH06J045376 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE CraniofacialAtlas 10.7 +49.6 49562 3.4 ZNF600 MYC IKZF1 SIX5 ZNF580 ATF2 KLF9 POLR2A ZNF223 ZNF10 SUPT3H lnc-CLIC5-3 RUNX2 CDC5L
GH06J045386 Enhancer 0.8 FANTOM5 Ensembl ENCODE 10.7 +59.5 59496 2.3 ZBTB40 ATF3 CREB1 ATF7 CEBPB HMBOX1 RUNX2 SUPT3H FJ601678-060 ENSG00000271857 CLIC5
GH06J045443 Enhancer 1.7 FANTOM5 ENCODE CraniofacialAtlas dbSUPER 5.2 +117.7 117739 5.4 NCOR1 MYC ZNF600 SSRP1 JUND ZNF580 ZNF592 ATF2 KLF9 CEBPA SUPT3H RUNX2 HSALNG0050325 HSALNG0050326 CLIC5
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data from 2017 publication | Request up-to-date GeneHancer data (full dataset)

GeneHancers around RUNX2 on the GeneHancer Hub at the UCSC Golden Path

Cistromic (ChIP-Seq) regulation report from SPP (The Signaling Pathways Project) for RUNX2

Top Transcription factor binding sites by QIAGEN in the RUNX2 gene promoter:
  • AP-1
  • C/EBPalpha
  • MyoD
  • PPAR-gamma1
  • PPAR-gamma2

Genomic Locations for RUNX2 Gene

Latest Assembly
chr6:45,328,157-45,664,349
(GRCh38/hg38)
Size:
336,193 bases
Orientation:
Plus strand

Previous Assembly
chr6:45,296,067-45,518,819
(GRCh37/hg19 by Entrez Gene)
Size:
222,753 bases
Orientation:
Plus strand

chr6:45,295,894-45,632,086
(GRCh37/hg19 by Ensembl)
Size:
336,193 bases
Orientation:
Plus strand

Genomic View for RUNX2 Gene

Genes around RUNX2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
RUNX2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for RUNX2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for RUNX2 Gene

Proteins for RUNX2 Gene

  • Protein details for RUNX2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q13950-RUNX2_HUMAN
    Recommended name:
    Runt-related transcription factor 2
    Protein Accession:
    Q13950
    Secondary Accessions:
    • O14614
    • O14615
    • O95181

    Protein attributes for RUNX2 Gene

    Size:
    521 amino acids
    Molecular mass:
    56648 Da
    Quaternary structure:
    • Heterodimer of an alpha and a beta subunit. The alpha subunit binds DNA as a monomer and through the Runt domain. DNA-binding is increased by heterodimerization. Interacts with XRCC6 (Ku70) and XRCC5 (Ku80). Interacts with HIVEP3. Interacts with IFI204. Interaction with SATB2; the interaction results in enhanced DNA binding and transactivation by these transcription factors. Binds to HIPK3. Interacts (isoform 3) with DDX5. Interacts with FOXO1 (via a C-terminal region); the interaction inhibits RUNX2 transcriptional activity towards BGLAP. This interaction is prevented on insulin or IGF1 stimulation as FOXO1 is exported from the nucleus (By similarity). Interacts with CCNB1, KAT6A and KAT6B. Interacts with FOXP3. Interacts with TMEM119 (By similarity). Interacts with OLFM2 (By similarity).

    Alternative splice isoforms for RUNX2 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for RUNX2 Gene

Post-translational modifications for RUNX2 Gene

  • Phosphorylated; probably by MAP kinases (MAPK). Phosphorylation by HIPK3 is required for the SPEN/MINT and FGF2 transactivation during osteoblastic differentiation (By similarity). Phosphorylation at Ser-451 by CDK1 promotes endothelial cell proliferation required for tumor angiogenesis probably by facilitating cell cycle progression. Isoform 3 is phosphorylated on Ser-340.
  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Antibodies for research

  • Abcam antibodies for RUNX2

No data available for DME Specific Peptides for RUNX2 Gene

Domains & Families for RUNX2 Gene

Gene Families for RUNX2 Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins
  • Transcription factors

Protein Domains for RUNX2 Gene

InterPro:
Blocks:
  • Acute myeloid leukemia 1 protein signature
  • Runx inhibition

Suggested Antigen Peptide Sequences for RUNX2 Gene

GenScript: Design optimal peptide antigens:
  • RUNX2 protein (Q32MY8_HUMAN)
  • Runt-related transcription factor 2 (Q5T801_HUMAN)
  • SL3/AKV core-binding factor alpha A subunit (RUNX2_HUMAN)

Graphical View of Domain Structure for InterPro Entry

Q13950

UniProtKB/Swiss-Prot:

RUNX2_HUMAN :
  • A proline/serine/threonine rich region at the C-terminus is necessary for transcriptional activation of target genes and contains the phosphorylation sites.
Domain:
  • A proline/serine/threonine rich region at the C-terminus is necessary for transcriptional activation of target genes and contains the phosphorylation sites.
genes like me logo Genes that share domains with RUNX2: view

Function for RUNX2 Gene

Molecular function for RUNX2 Gene

UniProtKB/Swiss-Prot Function:
Transcription factor involved in osteoblastic differentiation and skeletal morphogenesis (PubMed:28505335, PubMed:28738062, PubMed:28703881). Essential for the maturation of osteoblasts and both intramembranous and endochondral ossification. CBF binds to the core site, 5'-PYGPYGGT-3', of a number of enhancers and promoters, including murine leukemia virus, polyomavirus enhancer, T-cell receptor enhancers, osteocalcin, osteopontin, bone sialoprotein, alpha 1(I) collagen, LCK, IL-3 and GM-CSF promoters. In osteoblasts, supports transcription activation: synergizes with SPEN/MINT to enhance FGFR2-mediated activation of the osteocalcin FGF-responsive element (OCFRE) (By similarity). Inhibits KAT6B-dependent transcriptional activation.
GENATLAS Biochemistry:
Drosophila Runt pair rule-related transcription factor,expressed in T lymphocyte-derived cell lines,osteoblast-specific transcription factor,regulating osteoblast differentiation,binding to the osteocalcin promoter,regulated by BMP7 and vitamin D3,and essential for membranous and encochondreal bone formation,also involved in hematopoietic stem cells differentiation,

Phenotypes From GWAS Catalog for RUNX2 Gene

Gene Ontology (GO) - Molecular Function for RUNX2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000976 transcription regulatory region sequence-specific DNA binding IEA --
GO:0000978 RNA polymerase II proximal promoter sequence-specific DNA binding IBA 21873635
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific ISA --
GO:0000987 proximal promoter sequence-specific DNA binding IEA --
GO:0001228 DNA-binding transcription activator activity, RNA polymerase II-specific IEA --
genes like me logo Genes that share ontologies with RUNX2: view
genes like me logo Genes that share phenotypes with RUNX2: view

Human Phenotype Ontology for RUNX2 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for RUNX2 Gene

MGI Knock Outs for RUNX2:
Targeted motifs for RUNX2 Gene
HOMER Transcription Factor Regulatory Elements motif RUNX2
  • Consensus sequence: NWAACCACADNN Submotif: canonical Cell Type: PCa GEO ID: GSE33889

Inhibitory RNAs for research

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for RUNX2

Clone products for research

  • Addgene plasmids for RUNX2

No data available for Enzyme Numbers (IUBMB) and Transcription Factor Targets for RUNX2 Gene

Localization for RUNX2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for RUNX2 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for RUNX2 gene
Compartment Confidence
nucleus 5
cytosol 5
plasma membrane 3
extracellular 3
cytoskeleton 3
mitochondrion 2
peroxisome 2
endoplasmic reticulum 2
endosome 2
lysosome 2
golgi apparatus 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for RUNX2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000785 chromatin ISS --
GO:0005634 nucleus IDA 28505335
GO:0005654 nucleoplasm TAS --
GO:0005667 transcription factor complex IEA --
GO:0005737 cytoplasm IEA --
genes like me logo Genes that share ontologies with RUNX2: view

Pathways & Interactions for RUNX2 Gene

genes like me logo Genes that share pathways with RUNX2: view

Pathways by source for RUNX2 Gene

Gene Ontology (GO) - Biological Process for RUNX2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001501 skeletal system development IEA --
GO:0001503 ossification IBA,TAS 12217689
GO:0001649 osteoblast differentiation TAS 12217689
GO:0001958 endochondral ossification IEA --
GO:0002051 osteoblast fate commitment IEA --
genes like me logo Genes that share ontologies with RUNX2: view

Drugs & Compounds for RUNX2 Gene

(27) Drugs for RUNX2 Gene - From: DrugBank and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
3-Sulfinoalanine Experimental Pharma Target 0
O-Benzylsulfonyl-Serine Experimental Pharma Target 0

(21) Additional Compounds for RUNX2 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with RUNX2: view

Transcripts for RUNX2 Gene

mRNA/cDNA for RUNX2 Gene

5 REFSEQ mRNAs :
11 NCBI additional mRNA sequence :
12 Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :

Inhibitory RNAs for research

  • Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for RUNX2

Clone products for research

  • Addgene plasmids for RUNX2

Alternative Splicing Database (ASD) splice patterns (SP) for RUNX2 Gene

No ASD Table

Relevant External Links for RUNX2 Gene

GeneLoc Exon Structure for
RUNX2

Expression for RUNX2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for RUNX2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for RUNX2 Gene

This gene is overexpressed in Minor Salivary Gland (x4.2).

Protein differential expression in normal tissues from HIPED for RUNX2 Gene

This gene is overexpressed in CD8 Tcells (40.3) and CD4 Tcells (28.7).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for RUNX2 Gene



Protein tissue co-expression partners for RUNX2 Gene

Transcriptomic regulation report from SPP (The Signaling Pathways Project) for RUNX2

SOURCE GeneReport for Unigene cluster for RUNX2 Gene:

Hs.535845

mRNA Expression by UniProt/SwissProt for RUNX2 Gene:

Q13950-RUNX2_HUMAN
Tissue specificity: Specifically expressed in osteoblasts.

Evidence on tissue expression from TISSUES for RUNX2 Gene

  • Bone(4.7)
  • Bone marrow(3.2)
  • Blood(2.8)
  • Muscle(2.6)
  • Skin(2.4)
  • Lymph node(2.4)
  • Liver(2.3)
  • Kidney(2.3)
  • Heart(2.3)
  • Intestine(2.2)
  • Nervous system(2.2)
  • Spleen(2.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for RUNX2 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • digestive
  • immune
  • integumentary
  • nervous
  • respiratory
  • skeleton
Regions:
Head and neck:
  • brain
  • cheek
  • chin
  • ear
  • eye
  • face
  • forehead
  • head
  • jaw
  • lip
  • mandible
  • maxilla
  • middle ear
  • mouth
  • neck
  • nose
  • sinus
  • skull
  • tooth
Thorax:
  • chest wall
  • clavicle
  • lung
  • rib
  • rib cage
  • scapula
  • sternum
Pelvis:
  • pelvis
Limb:
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
General:
  • skin
  • spinal column
  • spinal cord
  • vertebrae
genes like me logo Genes that share expression patterns with RUNX2: view

Primer products for research

Orthologs for RUNX2 Gene

This gene was present in the common ancestor of animals.

Orthologs for RUNX2 Gene

Organism Taxonomy Gene Similarity Type Details
Dog
(Canis familiaris)
Mammalia RUNX2 30
  • 100 (a)
OneToOne
Chimpanzee
(Pan troglodytes)
Mammalia RUNX2 29 30
  • 99.74 (n)
OneToOne
Oppossum
(Monodelphis domestica)
Mammalia RUNX2 30
  • 97 (a)
OneToOne
Cow
(Bos Taurus)
Mammalia RUNX2 29 30
  • 95.24 (n)
OneToOne
Platypus
(Ornithorhynchus anatinus)
Mammalia RUNX2 30
  • 94 (a)
OneToOne
Mouse
(Mus musculus)
Mammalia Runx2 29 16 30
  • 93.86 (n)
OneToOne
Rat
(Rattus norvegicus)
Mammalia Runx2 29
  • 93.35 (n)
Chicken
(Gallus gallus)
Aves RUNX2 29 30
  • 87.78 (n)
OneToOne
Lizard
(Anolis carolinensis)
Reptilia RUNX2 30
  • 92 (a)
OneToOne
Tropical Clawed Frog
(Silurana tropicalis)
Amphibia runx2 29
  • 81.13 (n)
Zebrafish
(Danio rerio)
Actinopterygii runx2a 29 30
  • 76.86 (n)
OneToOne
Fruit Fly
(Drosophila melanogaster)
Insecta CG1379 31
  • 74 (a)
CG15455 31
  • 72 (a)
run 30 31
  • 21 (a)
ManyToMany
RunxA 30
  • 19 (a)
ManyToMany
RunxB 30
  • 17 (a)
ManyToMany
lz 30 31
  • 14 (a)
ManyToMany
Worm
(Caenorhabditis elegans)
Secernentea rnt-1 30
  • 28 (a)
OneToMany
Sea Squirt
(Ciona savignyi)
Ascidiacea -- 30
  • 63 (a)
OneToMany
Species where no ortholog for RUNX2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Eremothecium gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • Alpha proteobacteria (Wolbachia pipientis)
  • Amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • Baker's yeast (Saccharomyces cerevisiae)
  • Barley (Hordeum vulgare)
  • Beta proteobacteria (Neisseria meningitidis)
  • Bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • Common water flea (Daphnia pulex)
  • Corn (Zea mays)
  • E. coli (Escherichia coli)
  • Filamentous fungi (Aspergillus nidulans)
  • Firmicute Bacteria (Streptococcus pneumoniae)
  • Fission Yeast (Schizosaccharomyces pombe)
  • Green Algae (Chlamydomonas reinhardtii)
  • Honey Bee (Apis mellifera)
  • K. Lactis Yeast (Kluyveromyces lactis)
  • Loblloly Pine (Pinus taeda)
  • Malaria Parasite (Plasmodium falciparum)
  • Medicago Trunc (Medicago Truncatula)
  • Moss (Physcomitrella patens)
  • Orangutan (Pongo pygmaeus)
  • Pig (Sus scrofa)
  • Rainbow Trout (Oncorhynchus mykiss)
  • Rice (Oryza sativa)
  • Rice Blast Fungus (Magnaporthe grisea)
  • Schistosome Parasite (Schistosoma mansoni)
  • Sea Anemone (Nematostella vectensis)
  • Sea Vase (Ciona intestinalis)
  • Sea Urchin (Strongylocentrotus purpuratus)
  • Sorghum (Sorghum bicolor)
  • Soybean (Glycine max)
  • Stem Rust Fungus (Puccinia graminis)
  • Sugarcane (Saccharum officinarum)
  • Thale Cress (Arabidopsis thaliana)
  • Tomato (Lycopersicon esculentum)
  • Toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • Wheat (Triticum aestivum)

Evolution for RUNX2 Gene

ENSEMBL:
Gene Tree for RUNX2 (if available)
TreeFam:
Gene Tree for RUNX2 (if available)
Aminode:
Evolutionary constrained regions (ECRs) for RUNX2: view image
Alliance of Genome Resources:
Additional Orthologs for RUNX2

Paralogs for RUNX2 Gene

Paralogs for RUNX2 Gene

(5) SIMAP similar genes for RUNX2 Gene using alignment to 10 proteins:

  • RUNX2_HUMAN
  • F6RGB9_HUMAN
  • F8W8U5_HUMAN
  • I3L0L0_HUMAN
  • I3L354_HUMAN
  • I3L4L9_HUMAN
  • L8E7D8_HUMAN
  • Q32MY8_HUMAN
  • Q5T802_HUMAN
  • U3RG86_HUMAN
genes like me logo Genes that share paralogs with RUNX2: view

Variants for RUNX2 Gene

Sequence variations, with clinical significance, from ClinVar and Humsavar, with links to dbSNP for RUNX2 Gene

SNP ID Clinical significance and condition Chr 06 pos Variation AA Info Type
1010237 Uncertain Significance: not provided 45,422,693(+) A/ACAGCAGCAGCAGC
NM_001024630.4(RUNX2):c.172CAACAGCAGCAGCAGCAGCAG[3] (p.Gln65_Gln71dup)
INFRAME_INSERTION
1010388 Uncertain Significance: not provided 45,422,905(+) C/G
NM_001024630.4(RUNX2):c.371C>G (p.Ser124Trp)
MISSENSE
1016569 Uncertain Significance: not provided 45,438,013(+) C/A
NM_001024630.4(RUNX2):c.647C>A (p.Ala216Glu)
MISSENSE
1016635 Uncertain Significance: not provided 45,422,809(+) G/A
NM_001024630.4(RUNX2):c.275G>A (p.Arg92Gln)
MISSENSE
1022116 Uncertain Significance: not provided 45,422,732(+) GCA/G
NM_001024630.4(RUNX2):c.199_200del (p.Gln67fs)
FRAMESHIFT

dbSNP identifiers (rs#s) for variants without ClinVar clinical significance for RUNX2 Gene

All consequence types are included: molecular consequences (e.g. missense, synonymous), and location-based (e.g. intron, upstream).

Structural Variations from Database of Genomic Variants (DGV) for RUNX2 Gene

Variant ID Type Subtype PubMed ID
dgv1764e212 CNV loss 25503493
esv2476554 CNV deletion 19546169
esv3306539 CNV mobile element insertion 20981092
esv3401379 CNV insertion 20981092
esv3571035 CNV loss 25503493
esv3571036 CNV loss 25503493
nsv527552 CNV loss 19592680
nsv830652 CNV loss 17160897

Variation tolerance for RUNX2 Gene

Residual Variation Intolerance Score: 12.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.00; 36.97% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for RUNX2 Gene

Human Gene Mutation Database (HGMD)
RUNX2
SNPedia medical, phenotypic, and genealogical associations of SNPs for
RUNX2
Leiden Open Variation Database (LOVD)
RUNX2

SNP Genotyping and Copy Number Assays for research

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for RUNX2 Gene

Disorders for RUNX2 Gene

MalaCards: The human disease database

(83) MalaCards diseases for RUNX2 Gene - From: OMI, CVR, GTR, ORP, SWI, COP, and GCD

- elite association - COSMIC cancer census association via MalaCards
Search RUNX2 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

RUNX2_HUMAN
  • Cleidocranial dysplasia (CLCD) [MIM:119600]: Autosomal dominant skeletal disorder with high penetrance and variable expressivity. It is due to defective endochondral and intramembranous bone formation. Typical features include hypoplasia/aplasia of clavicles, patent fontanelles, wormian bones (additional cranial plates caused by abnormal ossification of the calvaria), supernumerary teeth, short stature, and other skeletal changes. In some cases defects in RUNX2 are exclusively associated with dental anomalies. {ECO:0000269 PubMed:10521292, ECO:0000269 PubMed:10545612, ECO:0000269 PubMed:10689183, ECO:0000269 PubMed:10980549, ECO:0000269 PubMed:11857736, ECO:0000269 PubMed:12081718, ECO:0000269 PubMed:12196916, ECO:0000269 PubMed:12424590, ECO:0000269 PubMed:16270353, ECO:0000269 PubMed:19744171, ECO:0000269 PubMed:20082269, ECO:0000269 PubMed:20648631, ECO:0000269 PubMed:24984680, ECO:0000269 PubMed:28505335, ECO:0000269 PubMed:28703881, ECO:0000269 PubMed:28738062, ECO:0000269 PubMed:9182765, ECO:0000269 PubMed:9207800}. Note=The disease is caused by variants affecting the gene represented in this entry.
  • Metaphyseal dysplasia with maxillary hypoplasia with or without brachydactyly (MDMHB) [MIM:156510]: An autosomal dominant bone dysplasia characterized by metaphyseal flaring of long bones, enlargement of the medial halves of the clavicles, maxillary hypoplasia, variable brachydactyly, and dystrophic teeth. {ECO:0000269 PubMed:23290074}. Note=The disease is caused by variants affecting the gene represented in this entry. Analysis for copy-number variations revealed that a 105 kb duplication within RUNX2 segregated with the MDMHB phenotype in a region with maximum linkage. Real-time PCR for copy-number variation in genomic DNA in eight samples, as well as sequence analysis of fibroblast cDNA from one subject with MDMHB confirmed that affected family members were heterozygous for the presence of an intragenic duplication encompassing exons 3 to 5 of RUNX2. These three exons code for the Q/A domain and the functionally essential DNA-binding Runt domain of RUNX2. The RUNX2 duplication found in individuals with MDMHB leads to a gain of function (PubMed:23290074). {ECO:0000269 PubMed:23290074}.

Additional Disease Information for RUNX2

Human Genome Epidemiology Navigator
(HuGE)
Atlas
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
Open Targets Platform
Open Targets Platform
genes like me logo Genes that share disorders with RUNX2: view

No data available for Genatlas for RUNX2 Gene

Publications for RUNX2 Gene

  1. Metaphyseal dysplasia with maxillary hypoplasia and brachydactyly is caused by a duplication in RUNX2. (PMID: 23290074) Moffatt P … Rauch F (American journal of human genetics 2013) 3 4 72
  2. Deletions of the RUNX2 gene are present in about 10% of individuals with cleidocranial dysplasia. (PMID: 20648631) Ott CE … Klopocki E (Human mutation 2010) 3 4 40
  3. Novel promoter polymorphism in RUNX2 is associated with serum triglyceride level. (PMID: 18688176) Shin HD … Han BG (Molecules and cells 2008) 3 22 40
  4. Cell cycle-dependent phosphorylation of the RUNX2 transcription factor by cdc2 regulates endothelial cell proliferation. (PMID: 16407259) Qiao M … Passaniti A (The Journal of biological chemistry 2006) 3 4 22
  5. Four novel RUNX2 mutations including a splice donor site result in the cleidocranial dysplasia phenotype. (PMID: 16270353) Kim HJ … Choi JY (Journal of cellular physiology 2006) 3 4 22

Products for RUNX2 Gene

Sources for RUNX2 Gene