Free for academic non-profit institutions. Other users need a Commercial license
This gene is a member of the RUNX family of transcription factors and encodes a nuclear protein with an Runt DNA-binding domain. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affini... See more...
Aliases for RUNX2 Gene
Aliases for RUNX2 Gene
- RUNX Family Transcription Factor 2 2 3 5
- Runt-Related Transcription Factor 2 2 3 4
- AML3 2 3 4
- Polyomavirus Enhancer-Binding Protein 2 Alpha A Subunit 3 4
- SL3/AKV Core-Binding Factor Alpha A Subunit 3 4
- Osteoblast-Specific Transcription Factor 2 3 4
- SL3-3 Enhancer Factor 1 Alpha A Subunit 3 4
- Runt Related Transcription Factor 2 2 3
- Acute Myeloid Leukemia 3 Protein 3 4
- Oncogene AML-3 3 4
- PEBP2-Alpha A 3 4
- PEA2-Alpha A 3 4
- CBF-Alpha-1 3 4
External Ids for RUNX2 Gene
- HGNC: 10472
- NCBI Entrez Gene: 860
- Ensembl: ENSG00000124813
- OMIM®: 600211
- UniProtKB/Swiss-Prot: Q13950
Previous HGNC Symbols for RUNX2 Gene
- CCD
- CBFA1
- CCD1
Previous GeneCards Identifiers for RUNX2 Gene
- GC06P045392
- GC06P045437
- GC06P045498
- GC06P045295
- GC06P045018
- GC06P045327
- GC06P047551
- GC06P049605
Summaries for RUNX2 Gene
-
This gene is a member of the RUNX family of transcription factors and encodes a nuclear protein with an Runt DNA-binding domain. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Two regions of potential trinucleotide repeat expansions are present in the N-terminal region of the encoded protein, and these and other mutations in this gene have been associated with the bone development disorder cleidocranial dysplasia (CCD). Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Jul 2016]
GeneCards Summary for RUNX2 Gene
RUNX2 (RUNX Family Transcription Factor 2) is a Protein Coding gene. Diseases associated with RUNX2 include Cleidocranial Dysplasia and Metaphyseal Dysplasia With Maxillary Hypoplasia With Or Without Brachydactyly. Among its related pathways are Notch-mediated HES/HEY network and Androgen receptor signaling pathway. Gene Ontology (GO) annotations related to this gene include DNA-binding transcription factor activity and RNA polymerase II proximal promoter sequence-specific DNA binding. An important paralog of this gene is RUNX1.
UniProtKB/Swiss-Prot Summary for RUNX2 Gene
-
Transcription factor involved in osteoblastic differentiation and skeletal morphogenesis (PubMed:28505335, PubMed:28738062, PubMed:28703881). Essential for the maturation of osteoblasts and both intramembranous and endochondral ossification. CBF binds to the core site, 5'-PYGPYGGT-3', of a number of enhancers and promoters, including murine leukemia virus, polyomavirus enhancer, T-cell receptor enhancers, osteocalcin, osteopontin, bone sialoprotein, alpha 1(I) collagen, LCK, IL-3 and GM-CSF promoters. In osteoblasts, supports transcription activation: synergizes with SPEN/MINT to enhance FGFR2-mediated activation of the osteocalcin FGF-responsive element (OCFRE) (By similarity). Inhibits KAT6B-dependent transcriptional activation.
Additional gene information for RUNX2 Gene
No data available for CIViC Summary , Tocris Summary , PharmGKB "VIP" Summary , Rfam classification and piRNA Summary for RUNX2 Gene
Genomics for RUNX2 Gene
GeneHancer (GH) Regulatory Elements Pubs
Promoters and enhancers for RUNX2 Gene
- Elite GeneHancer and/or Elite GeneHancer-gene association
Download GeneHancer data from 2017 publication |
Request up-to-date GeneHancer data (full dataset)
GeneHancers around RUNX2 on the GeneHancer Hub at the UCSC Golden Path
Cistromic (ChIP-Seq) regulation report from SPP (The Signaling Pathways Project) for RUNX2
- Top Transcription factor binding sites by QIAGEN in the RUNX2 gene promoter:
-
- AP-1
- C/EBPalpha
- MyoD
- PPAR-gamma1
- PPAR-gamma2
Genomic Locations for RUNX2 Gene
Latest Assembly
- chr6:45,328,157-45,664,349
- (GRCh38/hg38)
- Size:
- 336,193 bases
- Orientation:
- Plus strand
Previous Assembly
- chr6:45,296,067-45,518,819
- (GRCh37/hg19 by Entrez Gene)
- Size:
- 222,753 bases
- Orientation:
- Plus strand
Genomic View for RUNX2 Gene
Genes around RUNX2 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 6p21.1 by HGNC
- 6p21.1 by Entrez Gene
- 6p21.1 by Ensembl
RUNX2 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for RUNX2 Gene
Proteins for RUNX2 Gene
-
Protein details for RUNX2 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q13950-RUNX2_HUMAN
- Recommended name:
- Runt-related transcription factor 2
- Protein Accession:
- Q13950
- O14614
- O14615
- O95181
Protein attributes for RUNX2 Gene
- Size:
- 521 amino acids
- Molecular mass:
- 56648 Da
- Quaternary structure:
-
- Heterodimer of an alpha and a beta subunit. The alpha subunit binds DNA as a monomer and through the Runt domain. DNA-binding is increased by heterodimerization. Interacts with XRCC6 (Ku70) and XRCC5 (Ku80). Interacts with HIVEP3. Interacts with IFI204. Interaction with SATB2; the interaction results in enhanced DNA binding and transactivation by these transcription factors. Binds to HIPK3. Interacts (isoform 3) with DDX5. Interacts with FOXO1 (via a C-terminal region); the interaction inhibits RUNX2 transcriptional activity towards BGLAP. This interaction is prevented on insulin or IGF1 stimulation as FOXO1 is exported from the nucleus (By similarity). Interacts with CCNB1, KAT6A and KAT6B. Interacts with FOXP3. Interacts with TMEM119 (By similarity). Interacts with OLFM2 (By similarity).
Protein Expression for RUNX2 Gene
Post-translational modifications for RUNX2 Gene
- Phosphorylated; probably by MAP kinases (MAPK). Phosphorylation by HIPK3 is required for the SPEN/MINT and FGF2 transactivation during osteoblastic differentiation (By similarity). Phosphorylation at Ser-451 by CDK1 promotes endothelial cell proliferation required for tumor angiogenesis probably by facilitating cell cycle progression. Isoform 3 is phosphorylated on Ser-340.
- Modification sites at PhosphoSitePlus
- Modification sites at neXtProt
Other Protein References for RUNX2 Gene
Antibodies for research
- LifeSpan BioSciences CBFA1 / RUNX2 Monoclonal Antibody (LS-B4293) and CBFA1 / RUNX2 Monoclonal Antibody (LS-B4296)
- G Biosciences Immunotagā¢ RUNX2 Antibody
- NSJ Bioreagents RUNX2 Antibody
- BioLegend RUNX2 Antibody
-
Custom Antibody ServicesOriGene Antibodies for RUNX2
- Novus Biologicals Antibodies for RUNX2
-
Abcam antibodies for RUNX2
- Invitrogen Antibodies for RUNX2 (AFLGC-RUNX2)
-
Custom Antibody ServicesProSci Antibodies for RUNX2
-
Santa Cruz Biotechnology (SCBT) Antibodies for RUNX2
Protein products for research
-
OriGene Purified Proteins for RUNX2
- Search Origene for MassSpec and Protein Over-expression Lysates for RUNX2
- Origene Custom Protein Services for RUNX2
- antibodies-online: Show 12 available RUNX2 Proteins ranked by validation data
- Compare Top RUNX2 Proteins
-
Quality Products:
-
Abcam proteins for RUNX2
Assay products for research
-
Abcam assays for RUNX2
No data available for DME Specific Peptides for RUNX2 Gene
Domains & Families for RUNX2 Gene
Gene Families for RUNX2 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Disease related genes
- Predicted intracellular proteins
- Transcription factors
Protein Domains for RUNX2 Gene
- InterPro:
- Blocks:
-
- Acute myeloid leukemia 1 protein signature
- Runx inhibition
Suggested Antigen Peptide Sequences for RUNX2 Gene
- GenScript: Design optimal peptide antigens:
-
- RUNX2 protein (Q32MY8_HUMAN)
- Runt-related transcription factor 2 (Q5T801_HUMAN)
- SL3/AKV core-binding factor alpha A subunit (RUNX2_HUMAN)
Graphical View of Domain Structure for InterPro Entry
Q13950UniProtKB/Swiss-Prot:
RUNX2_HUMAN :- A proline/serine/threonine rich region at the C-terminus is necessary for transcriptional activation of target genes and contains the phosphorylation sites.
- Domain:
-
- A proline/serine/threonine rich region at the C-terminus is necessary for transcriptional activation of target genes and contains the phosphorylation sites.
Function for RUNX2 Gene
Molecular function for RUNX2 Gene
- UniProtKB/Swiss-Prot Function:
- Transcription factor involved in osteoblastic differentiation and skeletal morphogenesis (PubMed:28505335, PubMed:28738062, PubMed:28703881). Essential for the maturation of osteoblasts and both intramembranous and endochondral ossification. CBF binds to the core site, 5'-PYGPYGGT-3', of a number of enhancers and promoters, including murine leukemia virus, polyomavirus enhancer, T-cell receptor enhancers, osteocalcin, osteopontin, bone sialoprotein, alpha 1(I) collagen, LCK, IL-3 and GM-CSF promoters. In osteoblasts, supports transcription activation: synergizes with SPEN/MINT to enhance FGFR2-mediated activation of the osteocalcin FGF-responsive element (OCFRE) (By similarity). Inhibits KAT6B-dependent transcriptional activation.
- GENATLAS Biochemistry:
- Drosophila Runt pair rule-related transcription factor,expressed in T lymphocyte-derived cell lines,osteoblast-specific transcription factor,regulating osteoblast differentiation,binding to the osteocalcin promoter,regulated by BMP7 and vitamin D3,and essential for membranous and encochondreal bone formation,also involved in hematopoietic stem cells differentiation,
Phenotypes From GWAS Catalog for RUNX2 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000976 | transcription regulatory region sequence-specific DNA binding | IEA | -- |
| GO:0000978 | RNA polymerase II proximal promoter sequence-specific DNA binding | IBA | 21873635 |
| GO:0000981 | DNA-binding transcription factor activity, RNA polymerase II-specific | ISA | -- |
| GO:0000987 | proximal promoter sequence-specific DNA binding | IEA | -- |
| GO:0001228 | DNA-binding transcription activator activity, RNA polymerase II-specific | IEA | -- |
Phenotypes for RUNX2 Gene
- MGI mutant phenotypes for RUNX2:
-
inferred from 12 alleles
- nervous system phenotype
- muscle phenotype
- homeostasis/metabolism phenotype
- growth/size/body region phenotype
- cellular phenotype
- cardiovascular system phenotype
- immune system phenotype
- respiratory system phenotype
- mortality/aging
- liver/biliary system phenotype
- hematopoietic system phenotype
- digestive/alimentary phenotype
- endocrine/exocrine gland phenotype
- reproductive system phenotype
- vision/eye phenotype
- limbs/digits/tail phenotype
- skeleton phenotype
- integument phenotype
- craniofacial phenotype
- no phenotypic analysis
- GenomeRNAi human phenotypes for RUNX2:
-
- Increased vaccinia virus (VACV) infection
- Decreased viability
- shRNA abundance <= 25%
- shRNA abundance <= 50%
- no effect
- Inconclusive
- Increased epidermal growth factor (EGF) endocytosis
- Downregulation of NF-kappaB pathway after LMP1 stimulation
- Increased caspase activity
- Downregulation of NF-kappaB pathway after IL-1beta stimulation
- Downregulation of NF-kappaB pathway after TNFalpha stimulation
Animal Models for RUNX2 Gene
Animal Models for research
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
CRISPR products for research
- Applied Biological Materials (abm): CRISPR Clones for RUNX2 - Starting at $85 >
- * RUNX2 CRISPR as ready-to-use vector or virus: Non-viral | Lenti- | Adeno- | AAV- | siRNA - Browse All
- * Cas9 Nucleases, Nickases, Null Mutants, and GFP tag also available.
-
OriGene CRISPR knockouts for RUNX2
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for RUNX2
-
Santa Cruz Biotechnology (SCBT) CRISPR for RUNX2
miRNA for RUNX2 Gene
- miRTarBase miRNAs that target RUNX2
-
- mmu-miR-34c-5p (MIRT001958)
- mmu-miR-133a-3p (MIRT001959)
- mmu-miR-211-5p (MIRT003292)
- mmu-miR-204-5p (MIRT003293)
- hsa-miR-135b-5p (MIRT003597)
- hsa-miR-155-5p (MIRT004707)
- hsa-miR-335-5p (MIRT005888)
- hsa-miR-203a-3p (MIRT006037)
- hsa-miR-497-5p (MIRT006079)
- hsa-miR-195-5p (MIRT006080)
- mmu-miR-23a-3p (MIRT006565)
- hsa-miR-204-5p (MIRT006895)
- hsa-miR-433-3p (MIRT007225)
- hsa-miR-338-3p (MIRT007289)
- mmu-miR-2861 (MIRT007475)
- hsa-miR-124-3p (MIRT022898)
- hsa-miR-30d-5p (MIRT025969)
- hsa-miR-30a-5p (MIRT028618)
- hsa-miR-505-5p (MIRT037957)
- hsa-miR-484 (MIRT041692)
- hsa-miR-30b-5p (MIRT046115)
- mmu-miR-27a-3p (MIRT054433)
- hsa-miR-218-5p (MIRT054479)
- hsa-miR-23b-3p (MIRT054635)
- hsa-miR-34c-5p (MIRT054925)
- hsa-miR-30c-5p (MIRT219171)
- mmu-miR-338-3p (MIRT438698)
- mmu-miR-129-5p (MIRT581221)
- mmu-miR-3082-3p (MIRT581222)
- mmu-miR-5101 (MIRT581223)
- hsa-miR-205-5p (MIRT731506)
- hsa-miR-320a (MIRT731938)
- mmu-miR-455-3p (MIRT732297)
- hsa-miR-135a-5p (MIRT732537)
- hsa-miR-222-3p (MIRT732592)
- mmu-miR-467g (MIRT732840)
- hsa-miR-221-5p (MIRT734068)
- hsa-miR-628-3p (MIRT734212)
- hsa-miR-103a-3p (MIRT734231)
- hsa-miR-30a-3p (MIRT734621)
- hsa-miR-376c-3p (MIRT735369)
- rno-miR-503-5p (MIRT735372)
Targeted motifs for RUNX2 Gene
HOMER Transcription Factor Regulatory Elements motif RUNX2
- Consensus sequence: NWAACCACADNN Submotif: canonical Cell Type: PCa GEO ID: GSE33889
miRNA products for research
Inhibitory RNAs for research
- Origene shrna, sirna, and RNAi products in human, mouse, rat for RUNX2
- Browse OriGene Inhibitory RNA Products For RUNX2
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for RUNX2
Clone products for research
- Applied Biological Materials (abm): Clones for RUNX2 - Starting at $45 >
- * RUNX2 as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Retro- | Protein Vector - Browse All
- * Viral Packaging Services and High Titer Production Services also available.
-
- MG227321
- MG227455
- MG227541
- MR227321
- MR227321L3
- MR227321L4
- MR227455
- MR227541
- MR227541L1
- MR227541L2
- MR227541L3
- MR227541L4
- MR229828
- MR230001
- MR230394
- RC212884
- RC212884L1
- RC212884L2
- RC212884L3
- RC212884L4
- RC212936
- RC213097
- RC213097L1
- RC213097L2
- RC213097L3
- RC213097L4
- RC238506
- RG212884
- RG212936
- RG213097
- RR216824
- RR216859
- MR227321L3V
- MR227321L4V
- MR227541L1V
- MR227541L2V
- MR227541L3V
- MR227541L4V
- RC212884L1V
- RC212884L2V
- RC212884L3V
- RC212884L4V
- RC213097L1V
- RC213097L2V
- RC213097L3V
- RC213097L4V
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Addgene plasmids for RUNX2
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for RUNX2
Cell Lines for research
- ESI BIO PureStem SK11, NCr-fac & Meso-prx Progenitor and PureStem SM30, NCr-fac & Meso-latp Progenitor for RUNX2
-
Horizon Cell Lines for RUNX2
No data available for Enzyme Numbers (IUBMB) and Transcription Factor Targets for RUNX2 Gene
Localization for RUNX2 Gene
Subcellular locations from UniProtKB/Swiss-Prot for RUNX2 Gene
- Nucleus.
| Compartment | Confidence |
|---|---|
| nucleus | 5 |
| cytosol | 5 |
| plasma membrane | 3 |
| extracellular | 3 |
| cytoskeleton | 3 |
| mitochondrion | 2 |
| peroxisome | 2 |
| endoplasmic reticulum | 2 |
| endosome | 2 |
| lysosome | 2 |
| golgi apparatus | 1 |
- Nucleoplasm (4)
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000785 | chromatin | ISS | -- |
| GO:0005634 | nucleus | IDA | 28505335 |
| GO:0005654 | nucleoplasm | TAS | -- |
| GO:0005667 | transcription factor complex | IEA | -- |
| GO:0005737 | cytoplasm | IEA | -- |
Pathways & Interactions for RUNX2 Gene
Pathways by source for RUNX2 Gene
13 BioSystems pathways for RUNX2 Gene
3 Reactome pathways for RUNX2 Gene
2 KEGG pathways for RUNX2 Gene
2 GeneGo (Thomson Reuters) pathways for RUNX2 Gene
- Development_Hedgehog and PTH signaling pathways in bone and cartilage development
- Transcription_Role of VDR in regulation of genes involved in osteoporosis
Interacting Proteins for RUNX2 Gene
Selected Interacting proteins:
Q13950-RUNX2_HUMAN
ENSP00000360493
for RUNX2 Gene via
UniProtKB
STRING
IID
GPS-Prot Interaction Network for RUNX2
SIGNOR curated interactions for RUNX2 Gene
- Activates:
- Inactivates:
- Is activated by:
- Is inactivated by:
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0001501 | skeletal system development | IEA | -- |
| GO:0001503 | ossification | IBA,TAS | 12217689 |
| GO:0001649 | osteoblast differentiation | TAS | 12217689 |
| GO:0001958 | endochondral ossification | IEA | -- |
| GO:0002051 | osteoblast fate commitment | IEA | -- |
Transcripts for RUNX2 Gene
mRNA/cDNA for RUNX2 Gene
- 5 REFSEQ mRNAs :
- 11 NCBI additional mRNA sequence :
- 12 Ensembl transcripts including schematic representations, and UCSC links to gene/alias where relevant :
-
- ENST00000359524 5390 nts (view in UCSC)
- ENST00000371432 5487 nts (view in UCSC)
- ENST00000371436 1588 nts (view in UCSC)
- ENST00000371438 5698 nts (view in UCSC)
- ENST00000473041 283 nts (view in UCSC)
CRISPR products for research
- Applied Biological Materials (abm): CRISPR Clones for RUNX2 - Starting at $85 >
- * RUNX2 CRISPR as ready-to-use vector or virus: Non-viral | Lenti- | Adeno- | AAV- | siRNA - Browse All
- * Cas9 Nucleases, Nickases, Null Mutants, and GFP tag also available.
-
OriGene CRISPR knockouts for RUNX2
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for RUNX2
-
Santa Cruz Biotechnology (SCBT) CRISPR for RUNX2
miRNA products for research
Inhibitory RNAs for research
- Origene shrna, sirna, and RNAi products in human, mouse, rat for RUNX2
- Browse OriGene Inhibitory RNA Products For RUNX2
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for RUNX2
Clone products for research
- Applied Biological Materials (abm): Clones for RUNX2 - Starting at $45 >
- * RUNX2 as ready-to-use vector or virus: ORF | Lenti- | Adeno- | AAV- | Retro- | Protein Vector - Browse All
- * Viral Packaging Services and High Titer Production Services also available.
-
- MG227321
- MG227455
- MG227541
- MR227321
- MR227321L3
- MR227321L4
- MR227455
- MR227541
- MR227541L1
- MR227541L2
- MR227541L3
- MR227541L4
- MR229828
- MR230001
- MR230394
- RC212884
- RC212884L1
- RC212884L2
- RC212884L3
- RC212884L4
- RC212936
- RC213097
- RC213097L1
- RC213097L2
- RC213097L3
- RC213097L4
- RC238506
- RG212884
- RG212936
- RG213097
- RR216824
- RR216859
- MR227321L3V
- MR227321L4V
- MR227541L1V
- MR227541L2V
- MR227541L3V
- MR227541L4V
- RC212884L1V
- RC212884L2V
- RC212884L3V
- RC212884L4V
- RC213097L1V
- RC213097L2V
- RC213097L3V
- RC213097L4V
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Addgene plasmids for RUNX2
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for RUNX2
Relevant External Links for RUNX2 Gene
- GeneLoc Exon Structure for
- RUNX2
Expression for RUNX2 Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
-
Bone (Muscoskeletal System)
- Chondrocytes Zeugopod Epiphyseal End
- Fusing Suture Cells Rostral Sutures
- Immature Endochondral Osteoblasts Vertebrae
- Hypertrophic Chondrocytes Vertebrae
- Mesenchymal Condensate Cells Autopod
-
Cartilage (Muscoskeletal System)
- Chondrocytes Zeugopod Epiphyseal End
- Hypertrophic Chondrocytes Vertebrae
- Mesenchymal Condensate Cells Autopod
- Terminal Chondrocytes Caudal Facial Endochondral Bones
- Terminal Chondrocytes Mandibular Condyle
-
Limb (Muscoskeletal System)
- Mesenchymal Condensate Cells Autopod
- Mesenchymal Condensate Cells Stylopod
- Mesenchymal Condensate Cells Zeugopod
- Autopod
- Stylopod
- Neural Crest (Gastrulation Derivatives)
-
Tooth (Integumentary System)
- Early Ameloblasts Dental Enamel
- Dental Papilla Cells Dental Papilla
- Inner Enamel Epithelial Cells Dental Enamel
- Dental Follicle Cells Dental Papilla
- Ameloblasts Dental Enamel
- NULL (Uncategorized)
-
Head Mesenchyme (Muscoskeletal System)
- Osteochondro Progenitor Cells Branchial Arch 1
- Osteochondro Progenitor Cells Prechordal Mesenchyme
- Osteochondro Progenitor Cells Branchial Arch 2
- Blood (Cardiovascular System)
-
Epithelial Cells
- Early Ameloblasts Dental Enamel
- Inner Enamel Epithelial Cells Dental Enamel
-
Mesoderm (Gastrulation Derivatives)
- Mesothelial Cells Hepatic Mesenchyme
- Mesoderm-like cells(Oldershaw RA et. al. 2010)
-
Ovary (Reproductive System)
- Cumulus Cells Antral Follicle
-
Liver (Hepatobiliary System)
- Mesothelial Cells Hepatic Mesenchyme
-
Thymus (Hematopoietic System)
- T Helper Cells Thymus
- Brain (Nervous System)
- Gut Tube (Gastrointestinal Tract)
- Paraxial Mesoderm (Gastrulation Derivatives)
- Lateral Plate Mesoderm (Gastrulation Derivatives)
- Mesenchymal Stem Cells
- Umbilical Cord (Extraembryonic Tissues)
-
Pancreas (Endocrine System)
mRNA differential expression in normal tissues according to GTEx for RUNX2 Gene
This gene is overexpressed in Minor Salivary Gland (x4.2).
This gene is overexpressed in CD8 Tcells (40.3) and CD4 Tcells (28.7).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for RUNX2 Gene
Transcriptomic regulation report from SPP (The Signaling Pathways Project) for RUNX2
SOURCE GeneReport for Unigene cluster for RUNX2 Gene:
Hs.535845mRNA Expression by UniProt/SwissProt for RUNX2 Gene:
Q13950-RUNX2_HUMAN
Tissue specificity:
Specifically expressed in osteoblasts.
Evidence on tissue expression from TISSUES for RUNX2 Gene
- Bone(4.7)
- Bone marrow(3.2)
- Blood(2.8)
- Muscle(2.6)
- Skin(2.4)
- Lymph node(2.4)
- Liver(2.3)
- Kidney(2.3)
- Heart(2.3)
- Intestine(2.2)
- Nervous system(2.2)
- Spleen(2.1)
Phenotype-based relationships between genes and organs from Gene ORGANizer for RUNX2 Gene
Germ Layers:
- ectoderm
- endoderm
- mesoderm
Systems:
- digestive
- immune
- integumentary
- nervous
- respiratory
- skeleton
Regions:
Head and neck:
- brain
- cheek
- chin
- ear
- eye
- face
- forehead
- head
- jaw
- lip
- mandible
- maxilla
- middle ear
- mouth
- neck
- nose
- sinus
- skull
- tooth
Thorax:
- chest wall
- clavicle
- lung
- rib
- rib cage
- scapula
- sternum
Pelvis:
- pelvis
Limb:
- ankle
- arm
- digit
- elbow
- femur
- fibula
- finger
- foot
- forearm
- hand
- hip
- humerus
- knee
- lower limb
- radius
- shin
- shoulder
- thigh
- tibia
- toe
- ulna
- upper limb
- wrist
General:
- skin
- spinal column
- spinal cord
- vertebrae
Primer products for research
-
OriGene qPCR primer pairs for RUNX2
-
OriGene qPCR primer pairs and template standards for RUNX2
Gene Expression Assays for research
Orthologs for RUNX2 Gene
This gene was present in the common ancestor of animals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| Dog (Canis familiaris) |
Mammalia | RUNX2 30 |
|
OneToOne | |
| Chimpanzee (Pan troglodytes) |
Mammalia | RUNX2 29 30 |
|
OneToOne | |
| Oppossum (Monodelphis domestica) |
Mammalia | RUNX2 30 |
|
OneToOne | |
| Cow (Bos Taurus) |
Mammalia | RUNX2 29 30 |
|
OneToOne | |
| Platypus (Ornithorhynchus anatinus) |
Mammalia | RUNX2 30 |
|
OneToOne | |
| Mouse (Mus musculus) |
Mammalia | Runx2 29 16 30 |
|
OneToOne | |
| Rat (Rattus norvegicus) |
Mammalia | Runx2 29 |
|
||
| Chicken (Gallus gallus) |
Aves | RUNX2 29 30 |
|
OneToOne | |
| Lizard (Anolis carolinensis) |
Reptilia | RUNX2 30 |
|
OneToOne | |
| Tropical Clawed Frog (Silurana tropicalis) |
Amphibia | runx2 29 |
|
||
| Zebrafish (Danio rerio) |
Actinopterygii | runx2a 29 30 |
|
OneToOne | |
| Fruit Fly (Drosophila melanogaster) |
Insecta | CG1379 31 |
|
|
|
| CG15455 31 |
|
|
|||
| run 30 31 |
|
ManyToMany | |||
| RunxA 30 |
|
ManyToMany | |||
| RunxB 30 |
|
ManyToMany | |||
| lz 30 31 |
|
ManyToMany | |||
| Worm (Caenorhabditis elegans) |
Secernentea | rnt-1 30 |
|
OneToMany | |
| Sea Squirt (Ciona savignyi) |
Ascidiacea | -- 30 |
|
OneToMany |
- Species where no ortholog for RUNX2 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Eremothecium gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- Alpha proteobacteria (Wolbachia pipientis)
- Amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- Baker's yeast (Saccharomyces cerevisiae)
- Barley (Hordeum vulgare)
- Beta proteobacteria (Neisseria meningitidis)
- Bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- Common water flea (Daphnia pulex)
- Corn (Zea mays)
- E. coli (Escherichia coli)
- Filamentous fungi (Aspergillus nidulans)
- Firmicute Bacteria (Streptococcus pneumoniae)
- Fission Yeast (Schizosaccharomyces pombe)
- Green Algae (Chlamydomonas reinhardtii)
- Honey Bee (Apis mellifera)
- K. Lactis Yeast (Kluyveromyces lactis)
- Loblloly Pine (Pinus taeda)
- Malaria Parasite (Plasmodium falciparum)
- Medicago Trunc (Medicago Truncatula)
- Moss (Physcomitrella patens)
- Orangutan (Pongo pygmaeus)
- Pig (Sus scrofa)
- Rainbow Trout (Oncorhynchus mykiss)
- Rice (Oryza sativa)
- Rice Blast Fungus (Magnaporthe grisea)
- Schistosome Parasite (Schistosoma mansoni)
- Sea Anemone (Nematostella vectensis)
- Sea Vase (Ciona intestinalis)
- Sea Urchin (Strongylocentrotus purpuratus)
- Sorghum (Sorghum bicolor)
- Soybean (Glycine max)
- Stem Rust Fungus (Puccinia graminis)
- Sugarcane (Saccharum officinarum)
- Thale Cress (Arabidopsis thaliana)
- Tomato (Lycopersicon esculentum)
- Toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- Wheat (Triticum aestivum)
Evolution for RUNX2 Gene
- ENSEMBL:
- Gene Tree for RUNX2 (if available)
- TreeFam:
- Gene Tree for RUNX2 (if available)
- Aminode:
- Evolutionary constrained regions (ECRs) for RUNX2: view image
- Alliance of Genome Resources:
- Additional Orthologs for RUNX2
Paralogs for RUNX2 Gene
(5) SIMAP similar genes for RUNX2 Gene using alignment to 10 proteins:
- RUNX2_HUMAN
- F6RGB9_HUMAN
- F8W8U5_HUMAN
- I3L0L0_HUMAN
- I3L354_HUMAN
- I3L4L9_HUMAN
- L8E7D8_HUMAN
- Q32MY8_HUMAN
- Q5T802_HUMAN
- U3RG86_HUMAN
Variants for RUNX2 Gene
Sequence variations, with clinical significance, from ClinVar and Humsavar, with links to dbSNP for RUNX2 Gene
| SNP ID | Clinical significance and condition | Chr 06 pos | Variation | AA Info | Type |
|---|---|---|---|---|---|
| 1010237 | Uncertain Significance: not provided | 45,422,693(+) |
A/ACAGCAGCAGCAGC
NM_001024630.4(RUNX2):c.172CAACAGCAGCAGCAGCAGCAG[3] (p.Gln65_Gln71dup) |
INFRAME_INSERTION | |
| 1010388 | Uncertain Significance: not provided | 45,422,905(+) |
C/G NM_001024630.4(RUNX2):c.371C>G (p.Ser124Trp) |
MISSENSE | |
| 1016569 | Uncertain Significance: not provided | 45,438,013(+) |
C/A NM_001024630.4(RUNX2):c.647C>A (p.Ala216Glu) |
MISSENSE | |
| 1016635 | Uncertain Significance: not provided | 45,422,809(+) |
G/A NM_001024630.4(RUNX2):c.275G>A (p.Arg92Gln) |
MISSENSE | |
| 1022116 | Uncertain Significance: not provided | 45,422,732(+) |
GCA/G NM_001024630.4(RUNX2):c.199_200del (p.Gln67fs) |
FRAMESHIFT |
All consequence types are included: molecular consequences (e.g. missense, synonymous), and location-based (e.g. intron, upstream).
| Variant ID | Type | Subtype | PubMed ID |
|---|---|---|---|
| dgv1764e212 | CNV | loss | 25503493 |
| esv2476554 | CNV | deletion | 19546169 |
| esv3306539 | CNV | mobile element insertion | 20981092 |
| esv3401379 | CNV | insertion | 20981092 |
| esv3571035 | CNV | loss | 25503493 |
| esv3571036 | CNV | loss | 25503493 |
| nsv527552 | CNV | loss | 19592680 |
| nsv830652 | CNV | loss | 17160897 |
Residual Variation Intolerance Score:
12.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
2.00;
36.97% of all genes are more intolerant (likely to be disease-causing)
Additional Variant Information for RUNX2 Gene
SNP Genotyping and Copy Number Assays for research
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for RUNX2 Gene
Disorders for RUNX2 Gene
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| cleidocranial dysplasia |
|
|
| metaphyseal dysplasia with maxillary hypoplasia with or without brachydactyly |
|
|
| metaphyseal dysplasia |
|
|
| bone disease |
|
|
| brachydactyly |
|
|
Search RUNX2 in MalaCards
View complete list of genes associated with diseases
UniProtKB/Swiss-Prot
RUNX2_HUMAN- Cleidocranial dysplasia (CLCD) [MIM:119600]: Autosomal dominant skeletal disorder with high penetrance and variable expressivity. It is due to defective endochondral and intramembranous bone formation. Typical features include hypoplasia/aplasia of clavicles, patent fontanelles, wormian bones (additional cranial plates caused by abnormal ossification of the calvaria), supernumerary teeth, short stature, and other skeletal changes. In some cases defects in RUNX2 are exclusively associated with dental anomalies. {ECO:0000269 PubMed:10521292, ECO:0000269 PubMed:10545612, ECO:0000269 PubMed:10689183, ECO:0000269 PubMed:10980549, ECO:0000269 PubMed:11857736, ECO:0000269 PubMed:12081718, ECO:0000269 PubMed:12196916, ECO:0000269 PubMed:12424590, ECO:0000269 PubMed:16270353, ECO:0000269 PubMed:19744171, ECO:0000269 PubMed:20082269, ECO:0000269 PubMed:20648631, ECO:0000269 PubMed:24984680, ECO:0000269 PubMed:28505335, ECO:0000269 PubMed:28703881, ECO:0000269 PubMed:28738062, ECO:0000269 PubMed:9182765, ECO:0000269 PubMed:9207800}. Note=The disease is caused by variants affecting the gene represented in this entry.
- Metaphyseal dysplasia with maxillary hypoplasia with or without brachydactyly (MDMHB) [MIM:156510]: An autosomal dominant bone dysplasia characterized by metaphyseal flaring of long bones, enlargement of the medial halves of the clavicles, maxillary hypoplasia, variable brachydactyly, and dystrophic teeth. {ECO:0000269 PubMed:23290074}. Note=The disease is caused by variants affecting the gene represented in this entry. Analysis for copy-number variations revealed that a 105 kb duplication within RUNX2 segregated with the MDMHB phenotype in a region with maximum linkage. Real-time PCR for copy-number variation in genomic DNA in eight samples, as well as sequence analysis of fibroblast cDNA from one subject with MDMHB confirmed that affected family members were heterozygous for the presence of an intragenic duplication encompassing exons 3 to 5 of RUNX2. These three exons code for the Q/A domain and the functionally essential DNA-binding Runt domain of RUNX2. The RUNX2 duplication found in individuals with MDMHB leads to a gain of function (PubMed:23290074). {ECO:0000269 PubMed:23290074}.
Additional Disease Information for RUNX2
- Human Genome Epidemiology Navigator
- (HuGE)
- Atlas
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
- Open Targets Platform
- Open Targets Platform
No data available for Genatlas for RUNX2 Gene
Publications for RUNX2 Gene
- Metaphyseal dysplasia with maxillary hypoplasia and brachydactyly is caused by a duplication in RUNX2. (PMID: 23290074) Moffatt P ā¦ Rauch F (American journal of human genetics 2013) 3 4 72
- Deletions of the RUNX2 gene are present in about 10% of individuals with cleidocranial dysplasia. (PMID: 20648631) Ott CE ā¦ Klopocki E (Human mutation 2010) 3 4 40
- Novel promoter polymorphism in RUNX2 is associated with serum triglyceride level. (PMID: 18688176) Shin HD ā¦ Han BG (Molecules and cells 2008) 3 22 40
- Cell cycle-dependent phosphorylation of the RUNX2 transcription factor by cdc2 regulates endothelial cell proliferation. (PMID: 16407259) Qiao M ā¦ Passaniti A (The Journal of biological chemistry 2006) 3 4 22
- Four novel RUNX2 mutations including a splice donor site result in the cleidocranial dysplasia phenotype. (PMID: 16270353) Kim HJ ā¦ Choi JY (Journal of cellular physiology 2006) 3 4 22
ExternalLinks
Products for RUNX2 Gene
- Custom Antibody ServicesOriGene Antibodies for RUNX2
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for RUNX2
- Search Origene for MassSpec and Protein Over-expression Lysates for RUNX2
- Origene Custom Protein Services for RUNX2
- Origene shrna, sirna, and RNAi products in human, mouse, rat for RUNX2
- Browse OriGene Inhibitory RNA Products For RUNX2
- OriGene qPCR primer pairs for RUNX2
- OriGene qPCR primer pairs and template standards for RUNX2
- OriGene CRISPR knockouts for RUNX2
- MG227321
- MG227455
- MG227541
- MR227321
- MR227321L3
- MR227321L4
- MR227455
- MR227541
- MR227541L1
- MR227541L2
- MR227541L3
- MR227541L4
- MR229828
- MR230001
- MR230394
- RC212884
- RC212884L1
- RC212884L2
- RC212884L3
- RC212884L4
- RC212936
- RC213097
- RC213097L1
- RC213097L2
- RC213097L3
- RC213097L4
- RC238506
- RG212884
- RG212936
- RG213097
- RR216824
- RR216859
- MR227321L3V
- MR227321L4V
- MR227541L1V
- MR227541L2V
- MR227541L3V
- MR227541L4V
- RC212884L1V
- RC212884L2V
- RC212884L3V
- RC212884L4V
- RC213097L1V
- RC213097L2V
- RC213097L3V
- RC213097L4V
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For RUNX2
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse ELISA Kits
- Browse CRO Services
- High-throughput Antibody Production Service
- Protein Production Service
- Epitope Tag Antibodies & Reporter Protein Antibodies
- Lentiviral ORF Clones
- Novus Biologicals Antibodies for RUNX2
- Novus Biologicals proteins and lysates for RUNX2
- Browse Antibodies
- Browse Peptides and Proteins
- Browse Lysates
- Browse ELISA Kits
- Abcam antibodies for RUNX2
- Abcam proteins for RUNX2
- Abcam assays for RUNX2
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- ESI BIO PureStem SK11, NCr-fac & Meso-prx Progenitor and PureStem SM30, NCr-fac & Meso-latp Progenitor for RUNX2
- Invitrogen Antibodies for RUNX2 (AFLGC-RUNX2)
- VectorBuilder Custom and pre-made DNA vectors for RUNX2 (ie. gene expression, shRNA knockdown, CRISPR)
- VectorBuilder Viral vectors for RUNX2 (ie. lentivirus, AAV, adenovirus)
- VectorBuilder CRISPR vectors for RUNX2 (ie. knockout, knockin, CRISPRa, CRISPRi)
- VectorBuilder Virus packaging for RUNX2 CRISPR vectors (ie. lentivirus, AAV, adenovirus)
- VectorBuilder Stable cell line generation for RUNX2
- Addgene plasmids for RUNX2
- antibodies-online: Show 68 available RUNX2 Antibodies ranked by validation data
- Compare Top RUNX2 Antibodies
- antibodies-online: Show 60 available RUNX2 Elisa Kits ranked by validation data
- Compare Top RUNX2 Elisa Kits
- antibodies-online: Show 12 available RUNX2 Proteins ranked by validation data
- Compare Top RUNX2 Proteins
- Quality Products:
- Santa Cruz Biotechnology (SCBT) Antibodies for RUNX2
- Search Santa Cruz Biotechnology (SCBT) for RUNX2 siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for RUNX2
- Custom Antibody ServicesProSci Antibodies for RUNX2
- Search for RUNX2 Proteins at ProSci
- Horizon Cell Lines for RUNX2
- Browse GeneCopoeia Cell Lines
- Search GeneCopoeia for CRISPR/Cas9 clones, lentivirus and AAV products for RUNX2
- Search GeneCopoeia for ORF cDNA, lentivirus, AAV viral particles and/or promoter clone products for RUNX2
- Search GeneCopoeia for miRNA 3'UTR Target clone products for RUNX2
- Search GeneCopoeia for shRNA, lentivirus and/or AAV clone products for RUNX2
Sources for RUNX2 Gene
- (1) GeneCards
- (2) HGNC
- (3) NCBI Entrez Gene
- (4) UniProtKB/Swiss-Prot
- (5) Ensembl
- (6) OMIM® (Updated: 05-Apr-2021)
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) Cell Signaling Technology
- (12) GO
- (13) UniProtKB/TrEMBL
- (14) InterPro
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) ASD
- (27) SAGE
- (28) SOURCE
- (29) HomoloGene
- (30) PanEnsembl
- (31) euGenes
- (32) SGD
- (33) FlyBase
- (34) WormBase
- (35) Pseudogene
- (36) DGV
- (37) dbSNP
- (38) GenAtlas
- (39) HGMD
- (40) GAD
- (41) BGMUT
- (42) HuGE
- (43) Atlas
- (44) GenBank
- (45) HORDE
- (46) HUGE
- (47) IMGT
- (48) Leiden
- (49) miRBase
- (50) DME
- (51) OriGene
- (52) PubMed
- (53) R&D Systems
- (54) Tocris
- (55) Abcam
- (56) Novus Biologicals
- (57)