Free for academic non-profit institutions. Other users need a Commercial license

Aliases for RNU4-1 Gene

Subcategory (RNA class) for RNU4-1 Gene

snRNA

Quality Score for this RNA gene is

3

Aliases for RNU4-1 Gene

  • RNA, U4 Small Nuclear 1 2 3 5
  • RNA, U4B2 Small Nuclear 2 3
  • RNA, U4A Small Nuclear 2 3
  • RNU4B2 3
  • RNU4A 3
  • U4BL 3
  • U4 3

External Ids for RNU4-1 Gene

ORGUL Members for RNU4-1 Gene

Previous HGNC Symbols for RNU4-1 Gene

  • RNU4B2
  • RNU4A

Previous GeneCards Identifiers for RNU4-1 Gene

  • GC12U900787
  • GC12M119218
  • GC12M120730
  • GC12M117739

Summaries for RNU4-1 Gene

GeneCards Summary for RNU4-1 Gene

RNU4-1 (RNA, U4 Small Nuclear 1) is an RNA Gene, and is affiliated with the snRNA class. Among its related pathways are Spliceosomal Splicing Cycle.

Additional gene information for RNU4-1 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for RNU4-1 Gene

Genomics for RNU4-1 Gene

GeneHancer (GH) Regulatory Elements for RNU4-1 Gene

Promoters and enhancers for RNU4-1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH12I120290 Promoter/Enhancer 2.4 EPDnew Ensembl ENCODE dbSUPER 550.8 +1.0 1007 3.4 CLOCK MLX ZFP64 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ZNF143 SIRT4 GC12M120292 GC12M120294 RNU4-1 RNU4-2 GCN1 RAB35 PXN SRSF9 RPLP0
GH12I120223 Promoter/Enhancer 2.3 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 12.3 +61.7 61652 16 CLOCK MLX FEZF1 DMAP1 YY1 SLC30A9 ZNF213 ZNF143 ZNF263 SP3 PXN SIRT4 RPLP0 RNU4-1 RNU4-2 PXN-AS1 PLA2G1B GCN1 RAB35 MSI1
GH12I120239 Promoter/Enhancer 2.2 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 11.8 +43.7 43707 19.3 PKNOX1 SMAD1 FOXA2 ARNT ZNF2 ZNF766 E2F8 FOS REST ZNF592 PXN SIRT4 RNU4-2 RNU4-1 RNU6-1088P PLA2G1B P2RX4 BICDL1 RNF10 RAB35
GH12I120222 Enhancer 0.6 ENCODE dbSUPER 11.8 +71.0 71024 0.2 BCOR ZMYM3 KDM1A PXN RNU4-2 RNU4-1 GCN1 ENSG00000275936 GC12M120218
GH12I120220 Enhancer 0.6 ENCODE dbSUPER 11.8 +72.5 72454 1.2 GLIS1 ARID4B ZIC2 GC12M120218 PXN GCN1 RNU4-1 RNU4-2 ENSG00000275936
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around RNU4-1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the RNU4-1 gene promoter:

Genomic Locations for RNU4-1 Gene

Genomic Locations for RNU4-1 Gene
chr12:120,293,094-120,293,237
(GRCh38/hg38)
Size:
144 bases
Orientation:
Minus strand
chr12:120,730,897-120,731,040
(GRCh37/hg19)

Genomic View for RNU4-1 Gene

Genes around RNU4-1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
RNU4-1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for RNU4-1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for RNU4-1 Gene

Proteins for RNU4-1 Gene

Post-translational modifications for RNU4-1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for RNU4-1 Gene

Domains & Families for RNU4-1 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with RNU4-1: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for RNU4-1 Gene

Function for RNU4-1 Gene

Animal Model Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for RNU4-1 Gene

Localization for RNU4-1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for RNU4-1 Gene

Pathways & Interactions for RNU4-1 Gene

SuperPathways for RNU4-1 Gene

SuperPathway Contained pathways
1 Spliceosomal Splicing Cycle
genes like me logo Genes that share pathways with RNU4-1: view

Pathways by source for RNU4-1 Gene

1 Qiagen pathway for RNU4-1 Gene

Interacting Proteins for RNU4-1 Gene

Gene Ontology (GO) - Biological Process for RNU4-1 Gene

None

No data available for SIGNOR curated interactions for RNU4-1 Gene

Drugs & Compounds for RNU4-1 Gene

No Compound Related Data Available

Transcripts for RNU4-1 Gene

mRNA/cDNA for RNU4-1 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for RNU4-1 Gene

No ASD Table

Relevant External Links for RNU4-1 Gene

GeneLoc Exon Structure for
RNU4-1
ECgene alternative splicing isoforms for
RNU4-1

Expression for RNU4-1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for RNU4-1 Gene

mRNA differential expression in normal tissues according to GTEx for RNU4-1 Gene

This gene is overexpressed in Testis (x6.2), Whole Blood (x4.8), and Pancreas (x4.1).
genes like me logo Genes that share expression patterns with RNU4-1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for RNU4-1 Gene

Orthologs for RNU4-1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for RNU4-1 Gene

Organism Taxonomy Gene Similarity Type Details
mouse
(Mus musculus)
Mammalia Gm24265 34
  • 99 (a)
OneToOne
chimpanzee
(Pan troglodytes)
Mammalia U4 34
  • 99 (a)
OneToOne
cow
(Bos Taurus)
Mammalia U4 34
  • 98 (a)
OneToOne
dog
(Canis familiaris)
Mammalia U4 34
  • 98 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia U4 34
  • 97 (a)
ManyToMany
zebrafish
(Danio rerio)
Actinopterygii U4 34 34 34
  • 94 (a)
ManyToMany
Species where no ortholog for RNU4-1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for RNU4-1 Gene

ENSEMBL:
Gene Tree for RNU4-1 (if available)
TreeFam:
Gene Tree for RNU4-1 (if available)

Paralogs for RNU4-1 Gene

No data available for Paralogs for RNU4-1 Gene

Variants for RNU4-1 Gene

Sequence variations from dbSNP and Humsavar for RNU4-1 Gene

SNP ID Clin Chr 12 pos Variation AA Info Type
rs1000829757 -- 120,293,080(-) ACTGCAAGAAAATTCAGTCTCCGTAGAGACTG/ACTG downstream_transcript_variant, non_coding_transcript_variant
rs1001645897 -- 120,294,373(-) C/T upstream_transcript_variant
rs1001907162 -- 120,294,459(-) G/A/T upstream_transcript_variant
rs1002276069 -- 120,294,087(-) A/T upstream_transcript_variant
rs1002728504 -- 120,293,064(-) /T downstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for RNU4-1 Gene

Variant ID Type Subtype PubMed ID
nsv560435 CNV loss 21841781
nsv832530 CNV loss 17160897

Additional Variant Information for RNU4-1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
RNU4-1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for RNU4-1 Gene

Disorders for RNU4-1 Gene

Additional Disease Information for RNU4-1

No disorders were found for RNU4-1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for RNU4-1 Gene

Publications for RNU4-1 Gene

  1. Genes for human U4 small nuclear RNA. (PMID: 3582982) Bark C … Pettersson U (Gene 1986) 2 3 58
  2. BS69/ZMYND11 reads and connects histone H3.3 lysine 36 trimethylation-decorated chromatin to regulated pre-mRNA processing. (PMID: 25263594) Guo R … Shi Y (Molecular cell 2014) 3 58
  3. Inhibition of U4 snRNA in human cells causes the stable retention of polyadenylated pre-mRNA in the nucleus. (PMID: 24796696) Hett A … West S (PloS one 2014) 3 58
  4. Implication of the SMN complex in the biogenesis and steady state level of the signal recognition particle. (PMID: 23221635) Piazzon N … Massenet S (Nucleic acids research 2013) 3 58
  5. The multifunctional human p100 protein 'hooks' methylated ligands. (PMID: 17632523) Shaw N … Rao Z (Nature structural & molecular biology 2007) 3 58

Products for RNU4-1 Gene

Sources for RNU4-1 Gene

Content
Loading form....